Transcript asmbl_68479

Sequence
Transcript Sequence for observation asmbl_68479 of TGE0000524:
GCCGGGTTTGGGGGTTGGGACCTCCGGCTGCAGGTCCGCCTGGGCCAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCGAGCCGCGACCCTTCCGGCCGTCCCCACCCCACCTCGCCGCCATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGCCTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCCGACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGCAAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTAGCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATATCCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACTGCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGGACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTCGATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGATAACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGAGAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTGGCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATTTTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTACTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGAAACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCTGTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCTGGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAGGAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAATCTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTAGTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAATTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGCGAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGATGTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAGAAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTACAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAGGCACAGGAGGATCTCTAAAGCAGTAGCCAAACACCACTTTGTAAAAGGACTCTTCCATCAGAGATGGGAAAACCATTGGGGAGGACTAGGACCCATATGGGAATTATTACCTCTCAGGGCCGAGAGGACAGAATGGATATAATCTGAATCCTGTTAAATTTTCTCTAAACTGTTTCTTAGCTGCACTGTTTATGGAAATACCAGGACCAGTTTATGTTTGTGGTTTTGGGAAAAATTATTTGTGTTGGGGGAAATGTTGTGGGGGTGGGGTTGAGTTGGGGGTATTTTCTAATTTTTTTTGTACATTTGGAACAGTGACAATAAATGAGACCCCTTTAAACTGTCTTATTTTCCACCAGATTGAGAACCAGATGTTCTCTACACACTATCACTGTTCAATAGAGCTTTCTTCAGTGATGGAAATGCTCTGTAATCTACACTGTTCAGTACAGGTAGCTACGGAGCATCTGAAATATGGCTAGAAACTACATTTTTGTTTTGATTAATTTAAATAGCCATACAGTTGCTACCATACTGGTCACGGCAGCTGTAGACTGACTGGGTCCATAGTTCATCACCTCAAAATTCTTTCAAAATTTATTATCTCTTTCTCTCCTTACATGTTTATTTCCCAGGCCTACCCTGGTGATTAGAACAGCTGAAGGGCCTTTCTTGTTAGGCTGTCCATGCCCTAAGGATGGGTTCCTGTTTATCCTTGCCACGCAGCTGAGCTTACTGCATGTTTATATCTCCCAAGGACTGTTCTCTGCTCAGAAATGCCCTGTCAAGGGTGTGGCATCACGCAGTTTCATCCAAGTTGTTTCAGGAATTGCTGACACTGCTGGGTGCAGTTCTATCCCCTAAAGCCTAGGGTGTGGCCCTTTAACTTCCCCTTCAGTAGAACTGGGAAAGGCAGTACCATTCCTAGTTATGAGTGAAGCATCCACTTTCTTTTGTAACAATGAGGAACAGAAAGGATAAGACTGAAGAGTGATCTTTTGTCCAACTAAACCATTTATCTCCTTTTGTAGGTAAATTCAAATCCTGCCCAGTTATAGTTTTCAGTCACTGGAGAATTCCAGGTAGGAGCCCTACTTTAGGTGATCCTAGGAACTCCTATGTTCAGAAAAGAATTTTCTTCCTACTATATAATTACAGTATTTAGCTGTCAATTTTAAGATGAATTTGGTAGAGCCTTATAGTAAAGTATGTATCTTGGTCACACACAAAGCTTGGAAAAAGTAAAAGATGTCTAAACCATAATCTTGTAACTCATAACATCTGGGCTGGGGCCCGGGGATCTAATTGTTTAGAGAGCCCCAAAAGTGGCTCAGATGTAAAGCCAGGGTTAAGAACCATCTGCCTTGGAAGATTTAAGGGAAACATATAAACTTGTACAAAGGACACAGAAGCAGTCAGTTTTAATTTTTTAGCCATGTTGGTAAAAGTTCATTTTCAGTACATGGGTAACACCCAGGCCCTTTCCCATTATATCCAGGTATGCTACAAGTTCTTTTAACTCTTATCAGAAGTTATTATTACTGTTTCCTTAGAGAGGCTACCAGGCTAAAATTCACTTAGTTTGGTTTGTCTAATGTCCTCATTATTTTATCCTGAAGATGATGTCATTTCTCAGGACTTGAAAATGACTTGGCTGAACTAAAGGTAAAAAAGCCAAGCCTCTGTCACTTTTCCTAGACTCCTAGGCACAGCTATGGAGTCTTTGCACAGTGCCCATACCCTAAAAATTAATAATGAAAACCAAACCTCAAGAACCTAGAGCAGCTCTCTACTTGCCACCATGGACTCCAGTGGTCAGCATAAGAAAAGCAGATAGTTGCATTCTATTTAGTTTATAGCTGCTTTGTTCCTTTGTGTTTCACTAAGCAGAGGCTCAAAAATTCCCTTGATAACTTCAGCTGCCCCTGTTCTTTTCCTCAAACTCCAGGATGAGACCTTTAATGTGGGACAATTTCTGGTGAAGGTACTCACAGCGACGCTTTTCTTCTCTGTAACTTGGGTACTGCTGCAGAGAAAAAGCATCCATGTCAAAAAGTAAAAATTCTCATTCTACC