Transcript asmbl_62855

Sequence
Transcript Sequence for observation asmbl_62855 of TGE0059861:
CTGGCTGAGGCGGCGCCAGTTGGCCGGGCACGGGGCTGCTGTAAGGCCGAGGTTGCGGCGGAAGCGGAGACCATGTTCCGAGCGGCGGCTCCGGGGCAGCTCCGGCGGGCGGCCTCATTGCTACGATTTCAGAGTACCCTGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTTTAAATACCATTACTGCAGCCACACGCCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAATGTGACAAGGTGGCACAAGATCTCTGTAAAGTAGCAGGCATAGCAAAAGTTCTGGTGGCTCAGCATGATGTGTACAAAGGCCTACTTCCAGAGGAACTGACACCATTGATTTTGGCAACTCAGAAGCAGTTCAATTACACACACATCTGTGCTGGAGCATCTGCCTTCGGAAAGAACCTTTTGCCCAGAGTAGCAGCCAAACTTGAGGTTGCCCCGATTTCTGACATCATTGCAATCAAGTCACCTGACACATTTGTGAGAACTATTTATGCAGGAAATGCTCTATGTACAGTGAAGTGTGATGAGAAAGTGAAAGTGTTTTCTGTCCGTGGAACATCCTTTGATGCTGCAGCAACAAGTGGCGGTAGTGCCAGTTCAGAAAAGGCATCAAGTACTTCACCAGTGGAAATATCAGAGTGGCTTGACCAGAAATTAACAAAAAGTGATCGACCAGAGCTAACAGGTGCCAAAGTGGTGGTATCTGGTGGTCGAGGCTTGAAGAGTGGAGAGAACTTTAAGTTGTTATATGACTTGGCAGATCAACTACATGCTGCAGTTGGTGCTTCCCGTGCTGCTGTTGATGCTGGCTTTGTTCCCAATGACATGCAAGTTGGACAGACGGGAAAAATAGTAGCACCAGAACTTTATATTGCTGTTGGAATATCTGGAGCCATCCAACATTTAGCTGGGATGAAAGACAGCAAGACAATTGTGGCAATTAATAAAGACCCAGAAGCTCCAATTTTCCAAGTGGCAGATTATGGAATAGTTGCAGATTTATTTAAGGTAGTTCCTGAAATGACTGAGATATTGAAGAAAAAATGAATCAGGATCATGCCTTAAAAAGAAAACTTTTGTTAAAGTATTCCACTGAAATCACAGATATTTGTGGGTATTATAACAATCATTGGAAAGCATGGAGAGCTACATTTCATAATTTGAGGGAAAATTTCTAACAGATGCCAGAATGCTTGTTTATGGGATTGCTGTGTTTCCTTTTAATTATTTGTGGTTCCAAACAATTATTGTTTGAACTTTTTAAATTCTGTACTAAAATCTATAATAAAGCTTTTCCACAGCTTTAAAACTATCAGAAATATGCCTAGCCTCTAGAGAAAATTGAAGAAAAGGAGTAAAAATTTTGTTTATTTATTTATTTTTTTGCCTTTCTTGTTCATGGAGAGCTCTATGTTTTAGGAAGATTGTAAACATGATTGTCTCCACCAGCCTAATCAACCTACTAATCTCATTGTTGAAGGGCAAACTTCATAGGAGAAGGTAACTGAATTGGCAAGTGCAGAGTTAAAAAAGCACGGCTATAAAGCATGAATATTATCTTAAACATACTCCAGTCTTCAGAAGACCATAGCTAATGTGACAAAAGCAGACCTGACTTAAACCTGACCCAGCTCCATGTATTTAGTTGGCTTAAGGTAAATTTCATTTTCCGTTTAATTTTAAGGTTTTGTCAGTTTATAGGACTTTTGTCTGTAAAGGAGGGAGAGTGGAGGAGGGGCTGCTTTGAGACAGCATGGCCTCTGATGCAAGCAGATAGTTTGATGTTATTATAAACATTCAAAATCCTGTGCAGAGAATGCTCTAGCCTTTCTTTTGCCTTCTGTTGGCTTCTTTTGGGCTCTCTTAGGAAGCACCCAGGCCTGTGTAGTCACCTCTGGCACTCTCATTCTGCTGCCCAGGGCACAGCTGAGGTCCAAGAGTGTCACCAGGGCTGCAGCTGGTGTGGATGCAGGCCCAAGAGCAGAGGCTGGTGAGGCTTTGAACAGGCCTGCAGGAAGGCGTGGGTAGGTAGGTGAGTAGAACAAAGAGGGCTGCCCTCCTGAATCAGATCTGCAGAAGTAGGAGTAGTGACCTGGATCAAGCAGACAGTAGGGAAGAGAAGGGAAGTGATAAGTGATGGAGGTGGCTAGAGTGCCTTTGTGTGACCAGCCTGGGGCCCTTCCCCAGCTGACTAGTGAACCC