Transcript asmbl_61659

Sequence
Transcript Sequence for observation asmbl_61659 of TGE0056213:
GCTGTAGTGCTTCTGGGCAGTAGAGGCGCGGGGTGCGGAGCTAGGGCGGCCGAGAGCCATGGCGGCGCTATTGGCGGCGGCGGCAGTGCGAGCCCGGATCCTGCAGGTTTCTTCCAAGGTGAAATCCAGTCCCACCTGGTATTCAGCATCTTCCTTCTCTTCTTCAGTGCCAACTGTAAAGCTCTTCATTGGTGGGAAATTCGTTGAATCCAAAAGTGACAAATGGATCGATATCCACAACCCAGCCACCAATGAGGTCATTGGTCGGGTCCCTCAGGCCACCAAGGCAGAAATGGATGCAGCCATTGCTTCCTGCAAACGTGCTTTTCCTGCATGGGCAGACACTTCAGTATTAAGCCGCCAGCAGGTCTTGCTCCGCTATCAACAACTTATTAAAGAAAACTTGAAAGAAATTGCCAAGTTAATCACATTGGAACAAGGGAAGACCCTAGCTGATGCTGAAGGAGATGTATTTCGAGGCCTTCAGGTGGTTGAGCATGCCTGTAGTGTGACATCCCTCATGATGGGAGAGACCATGCCATCCATCACCAAAGACATGGACCTTTATTCCTACCGTCTGCCTCTGGGAGTGTGTGCAGGCATTGCTCCATTCAATTTTCCTGCCATGATCCCCCTTTGGATGTTTCCCATGGCCATGGTGTGTGGAAATACCTTCCTAATGAAACCATCTGAGCGAGTCCCTGGAGCAACTATGCTTCTTGCTAAGTTGCTCCAGGATTCTGGTGCCCCTGATGGAACATTAAACATCATCCATGGACAGCATGAAGCTGTAAATTTTATTTGCGATCATCCGGACATCAAAGCAATCAGCTTTGTGGGATCCAACAAGGCAGGAGAGTATATCTTCGAGAGAGGATCAAGACATGGCAAGAGGGTTCAAGCCAATATGGGAGCCAAGAACCATGGGGTAGTCATGCCAGATGCCAATAAGGAAAATACCCTGAACCAGCTGGTTGGGGCAGCATTTGGAGCTGCTGGTCAGCGCTGCATGGCTCTTTCAACAGCAGTCCTTGTGGGAGAAGCCAAGAAGTGGCTGCCAGAGCTGGTGGAGCATGCCAAAAACCTGAGAGTCAATGCAGGAGATCAGCCTGGAGCTGATCTTGGCCCTCTGATCACTCCCCAGGCCAAAGAGCGAGTCTGTAATCTGATTGATAGTGGAACAAAGGAGGGAGCTTCCATCCTTCTTGATGGACGAAAAATTAAAGTGAAAGGCTATGAAAATGGCAACTTTGTTGGACCAACCATCATCTCGAATGTCAAGCCAAATATGACCTGTTACAAAGAGGAGATTTTTGGTCCAGTTCTTGTGGTTCTGGAGACAGAAACATTGGATGAAGCCATCCAGATTGTAAATAACAACCCATATGGAAATGGAACTGCCATCTTCACCACCAATGGAGCCACTGCTCGGAAATATGCCCACTTGGTGGATGTTGGACAGGTGGGAGTGAATGTCCCCATTCCAGTGCCTTTGCCAATGTTCTCATTCACCGGCTCTCGATCCTCCTTCAGGGGAGACACCAATTTCTATGGCAAACAGGGCATCCAATTCTACACTCAGTTAAAGACCATTACTTCTCAGTGGAAAGAAGAAGATGCTACTCTTTCCTCACCTGCTGTTGTCATGCCTACCATGGGCCGTTAGAAACAAGTTTGTTTAAGACTGACTCCATCCTGAGTAATCTCCCTTTATTTTTGACCAGCTTCATTTGTCAGCTTTGCTCAGATCAGATCGATGGGATTGGAATACATTGTAACTAAAATCTTCCTCAGGACTATTAACCCCCGCAAAGTTTCTATAGGGAACTGCCTAGTGTAACAATGAAACCAGATTTCTCACTTGCTCTTCATACTTCTATTTTGAGGTAACTGTTGTAACTATGAAATGCTTATCTGAAAGTAGTGCTTAAACCTGATTTCTAAAAATTATCCCATTTTCTGATGATTTGAAGGGGAGAAAAGCCAGTGTATGTAAAGAAAATGTTCCAGCCAGGCGCGGTGGCTCACGC