Transcript asmbl_39856

Sequence
Transcript Sequence for observation asmbl_39856 of TGE0056176:
GCCCTTGTCATCTCTTAGGCCCCGTCTCACCCTTTCGGATGCCTCCCCTAGAACCCTACCACTTTCCACCCCTTTCCGTCTGTTATTTCTCCCAAACTTGCGCCCGCACAGGCCCCTCTGGAACACTCCTGCCCCGTAGTGCCCCTCGTCCCCGCTCCGTAGAGAAAGAGCGTGCGTGCCGCGCATTTCTGGCCTGGGGAGCGGGTGGAGTAAACCTGCGGGAACCATTTTACGACAACGTGCGGCTGTGCGGTGTGGCTGACGGCAACGCCGCTGCTCTTGGAGAGGTCACTCCGGAGACGGCGTTGGTTTTGGGGTGTGGGGGGTTGGTGGCACTATGTGGCGCGTCTGTGCGCGACGGGCTCAGAATGTAGCCCCATGGGCGGGACTCGAGGCTCGGTGGACGGCCTTGCAGGAGGTACCCGGAACTCCACGAGTGACCTCGCGATCTGGCCCGGCTCCCGCTCGTCGCAACAGCGTGACTACAGGGTATGGCGGGGTCCGGGCACTGTGCGGCTGGACCCCCAGTTCTGGGGCCACGCCGCGGAACCGCTTACTGCTGCAGCTTTTGGGGTCGCCCGGCCGCCGCTATTACAGTCTTCCCCCGCATCAGAAGGTTCCATTGCCTTCTCTTTCCCCCACAATGCAGGCAGGCACCATAGCCCGTTGGGAAAAAAAAGAGGGGGACAAAATCAATGAAGGTGACCTAATTGCAGAGGTTGAAACTGATAAAGCCACTGTTGGATTTGAGAGCCTGGAGGAGTGTTATATGGCAAAGATACTTGTTGCTGAAGGTACCAGGGATGTTCCCATCGGAGCGATCATCTGTATCACAGTTGGCAAGCCTGAGGATATTGAGGCCTTTAAAAATTATACACTGGATTCCTCAGCAGCACCTACCCCACAAGCGGCCCCAGCACCAACCCCTGCTGCCACTGCTTCGCCACCTACACCTTCTGCTCAGGCTCCTGGTAGCTCATATCCCCCTCACATGCAGGTACTTCTTCCTGCCCTCTCTCCCACCATGACCATGGGCACAGTTCAGAGATGGGAAAAAAAAGTGGGTGAGAAGCTAAGTGAAGGAGACTTACTGGCAGAGATAGAAACTGACAAAGCCACTATAGGTTTTGAAGTACAGGAAGAAGGTTATCTGGCAAAAATCCTGGTCCCTGAAGGCACAAGAGATGTCCCTCTAGGAACCCCACTCTGTATCATTGTAGAAAAAGAGGCAGATATATCAGCATTTGCTGACTATAGGCCAACCGAAGTAACAGATTTAAAACCACAAGTGCCACCACCTACCCCACCCCCGGTGGCCGCTGTTCCTCCAACTCCCCAGCCTTTAGCTCCTACACCTTCAGCACCCTGCCCAGCTACTCCTGCTGGACCAAAGGGAAGGGTGTTTGTTAGCCCTCTTGCAAAGAAGTTGGCAGTAGAGAAAGGGATTGATCTTACACAAGTAAAAGGGACAGGACCAGATGGTAGAATCACCAAGAAGGATATCGACTCTTTTGTGCCTAGTAAAGTTGCTCCTGCTCCGGCAGCTGTTGTGCCTCCCACAGGTCCTGGAATGGCACCAGTTCCTACAGGTGTCTTCACAGATATCCCAATCAGCAACATTCGTCGGGTTATTGCACAGCGATTAATGCAATCAAAGCAAACCATACCTCATTATTACCTTTCTATCGATGTAAATATGGGAGAAGTTTTGTTGGTACGGAAAGAACTTAATAAGATATTAGAAGGGAGAAGCAAAATTTCTGTCAATGACTTCATCATAAAAGCTTCAGCTTTGGCATGTTTAAAAGTTCCCGAAGCAAATTCTTCTTGGATGGACACAGTTATAAGACAAAATCATGTTGTTGATGTCAGTGTTGCGGTCAGTACTCCTGCAGGACTCATCACACCTATTGTGTTTAATGCACATATAAAAGGAGTGGAAACCATTGCTAATGATGTTGTTTCTTTAGCAACCAAAGCAAGAGAGGGTAAACTACAGCCACATGAATTCCAGGGTGGCACTTTTACGATCTCCAATTTAGGAATGTTTGGAATTAAGAATTTCTCTGCTATTATTAACCCACCTCAAGCATGTATTTTGGCAATTGGTGCTTCAGAGGATAAACTGGTCCCTGCAGATAATGAAAAAGGGTTTGATGTGGCTAGCATGATGTCTGTTACACTCAGTTGTGATCACCGGGTGGTGGATGGAGCAGTTGGAGCCCAGTGGCTTGCTGAGTTTAGAAAGTACCTTGAAAAACCTATCACTATGTTGTTGTAACTAACTCAAGAATTTCTAAACTCTCCCAGGTCACACTGATTCATTCTTAACAAGATATTTATATGTTATTAAACAGGTGGTTCTTTTTATTTTAACCAGTTATTTTTATTATTGAGTCTGTCCAGATAAGTTATTTATAATGGGCATTACTGAATTTTTAAAATGCCGATTACACCCAAATATTGTGCACATTTAATAATCAGACACCAGATTTTTAGCTCTGTACTCCTAATTAAGGGACATGTATGTGGCCTTGCCTAGCCCTTTGGTGATAAGTACTTCCTCTAGGAAATGTACGATAGGTAGAATTGTGGTTCCCTAAAGACAAGTACATAAAGGTGACCCTGATGAAACCTTGAAGTTCTGAAATTTAACTGCCTAAAATGTTCTCCTTAGATGTGAGAGAAAGAGAAATCAGAAAAATTAATTCTCTTGGGGGAAGGGCTTGAATTGAAGCTTTACTTTAGAATTTAGCCCTGGTTTGAAATTTTCCATTACATGATCTTGGTTTATCATCGATGGGAAGGGTAGAAAACTTCAAGGAAAATAAGTGAAATTTTAAAAGTCAGCATTTTCTTAGACCTCTTCAGCTGATTGTTTATTTTTCTATGAATTCCTACACATGGTTATTCCCCCCTACTTGAGATAATCTAAATATAAACCAGCTACTTGATGTAACTGAGAATTTGTGTGGATATTTATTTAAACAAATGTGTAATTTTGAGTACAGAATTCAACAGTTACCTCCAAAAAAGAAACATTGTTAATATAATTTAACAGAAGTTGTGAAACTAAAATTTTCTAAGATTAACTGGTAGTTCATTGTAAATGAACATAATGAACAGAATTTATGACTCCACTGTGGAAAATGCTATCAAATAACTAAGGAATATATATGGAATAAGTGTACATATGTAAAATATTGTTACTAGAGTTAGATATGTGCCAAAGTCCATTTATCCCAAATCCTGTCTGAAAAGGAGGGGTACATTGGTAAACATTTTGGAGTGCTTAAAAATGCCAAAAACAAAATGGTAATTTCTACTTTGATAAAGTAAAAAAGTTAAATGTGTGTAAAAAAGTGTTCTGTGTCCTTCTACTCCAGCATCGTCTCATGTAAAATAAGAAAGCCCTAAAATACTATTGGAGAGAAAAAATTAACTAGGTTGCTACTTTATTTGCCTAAATACTTTTTTCTATTTTGTTAGATTTTGCCTTTCTTTTGGAAGGAAGGAGGCGATATTCTGGATTATAAAAATGAATTGGGAACATTATCACAATTCCAGACTTTCTATTAATATTTATGTGTTTTAATAAACGTTTGAAATTATTTATGACTACTTAAAATGAATCTGACCAGTGCTTCCTGGTATATGTAATATGTGGAGTTAGCCCCTGAAATTTGCTTTAAGTGTTTCAGTGTTGAATCTGTTTCTAAATATTCATTATTACATGGTACACAAGTGACACTCCATATATTCCACACAGACTTTTACCTTGCTGTATTATTATGAAAACAATACATTAATTTGATTTTTCAGTAATTAGTAATTTTAGGTTGAAGATTATCCAAAAGAAACAAGCTTATCACAAGGGACCATCATCAATATGATCCAAATCTGGTTCAAACATTCAAAACTTCAAAGATAATTCATCTTTCGCTAATGCTTGTGGTTCTGTTGTTCCCTTGAAAAAAAATAAAAACAGTTGCCTTCTAATAAACATTGTTGAGTTAAAAATTAATCTGAGCTATAATCTAAATCGATTCAGTCTCTTACCAGAACTGAAAGAAAAAAGTTAGAAATAGTGTTTTTGGTTCATATGATTATTTAA