Transcript asmbl_39668

Sequence
Transcript Sequence for observation asmbl_39668 of TGE0000090:
CTTTTTTTGGCGGAGCTGGGGCGCCCTCCGGAAGCGTTTCCAACTTTCCAGAAGTTTCTCGGGACGGGCAGGAGGGGGTGGGGACTGCCATATATAGATCCCGGGAGCAGGGGAGCGGGCTAAGAGTAGAATCGTGTCGCGGCTCGAGAGCGAGAGTCACGTCCCGGCGCTAGCCCAGCCCGACCCAGAATGAAAAAGGCAGGCATTGACCTCCCTCTGAGGCAGTTTCCAGGCCCACCGTGGTGCACGCAAACCACTTCCTGGCCATGCGCTCCCTCCTGCTTCTCAGCGCCTTCTGCCTCCTGGAGGCGGCCCTGGCCGCCGAGGTGAAGAAACCTGCAGCCGCAGCAGCTCCTGGCACTGCGGAGAAGTTGAGCCCCAAGGCGGCCACGCTTGCCGAGCGCAGCGCCGGCCTGGCCTTCAGCTTGTACCAGGCCATGGCCAAGGACCAGGCAGTGGAGAACATCCTGGTGTCACCCGTGGTGGTGGCCTCGTCGCTAGGGCTCGTGTCGCTGGGCGGCAAGGCGACCACGGCGTCGCAGGCCAAGGCAGTGCTGAGCGCCGAGCAGCTGCGCGACGAGGAGGTGCACGCCGGCCTGGGCGAGCTGCTGCGCTCACTCAGCAACTCCACGGCGCGCAACGTGACCTGGAAGCTGGGCAGCCGACTGTACGGACCCAGCTCAGTGAGCTTCGCTGATGACTTCGTGCGCAGCAGCAAGCAGCACTACAACTGCGAGCACTCCAAGATCAACTTCCGCGACAAGCGCAGCGCGCTGCAGTCCATCAACGAGTGGGCCGCGCAGACCACCGACGGCAAGCTGCCCGAGGTCACCAAGGACGTGGAGCGCACGGACGGCGCCCTGCTAGTCAACGCCATGTTCTTCAAGCCACACTGGGATGAGAAATTCCACCACAAGATGGTGGACAACCGTGGCTTCATGGTGACTCGGTCCTATACCGTGGGTGTCATGATGATGCACCGGACAGGCCTCTACAACTACTACGACGACGAGAAGGAAAAGCTGCAAATCGTGGAGATGCCCCTGGCCCACAAGCTCTCCAGCCTCATCATCCTCATGCCCCATCACGTGGAGCCTCTCGAGCGCCTTGAAAAGCTGCTAACCAAAGAGCAGCTGAAGATCTGGATGGGGAAGATGCAGAAGAAGGCTGTTGCCATCTCCTTGCCCAAGGGTGTGGTGGAGGTGACCCATGACCTGCAGAAACACCTGGCTGGGCTGGGCCTGACTGAGGCCATTGACAAGAACAAGGCCGACTTGTCACGCATGTCAGGCAAGAAGGACCTGTACCTGGCCAGCGTGTTCCACGCCACCGCCTTTGAGTTGGACACAGATGGCAACCCCTTTGACCAGGACATCTACGGGCGCGAGGAGCTGCGCAGCCCCAAGCTGTTCTACGCCGACCACCCCTTCATCTTCCTAGTGCGGGACACCCAAAGCGGCTCCCTGCTATTCATTGGGCGCCTGGTCCGGCCTAAGGGTGACAAGATGCGAGACGAGTTATAGGGCCTCAGGGTGCACACAGGATGGCAGGAGGCATCCAAAGGCTCCTGAGACACATGGGTGCTATTGGGGTTGGGGGGGAGGTGAGGTACCAGCCTTGGATACTCCATGGGGTGGGGGTGGAAAAACAGACCGGGGTTCCCGTGTGCCTGAGCGGACCTTCCCAGCTAGAATTCACTCCACTTGGACATGGGCCCCAGATACCATGATGCTGAGCCCGGAAACTCCACATCCTGTGGGACCTGGGCCATAGTCATTCTGCCTGCCCTGAAAGTCCCAGATCAAGCCTGCCTCAATCAGTATTCATATTTATAGCCAGGTACCTTCTCACCTGTGAGACCAAATTGAGCTAGGGGGGTCAGCCAGCCCTCTTCTGACACTAAAACACCTCAGCTGCCTCCCCAGCTCTATCCCAACCTCTCCCAACTATAAAACTAGGTGCTGCAGCCCCTGGGACCAGGCACCCCCAGAATGACCTGGCCGCAGTGAGGCGGATTGAGAAGGAGCTCCCAGGAGGGGCTTCTGGGCAGACTCTGGTCAAGAAGCATCGTGTCTGGCGTTGTGGGGATGAACTTTTTGTTTTGTTTCTTCCTTTTTTAGTTCTTCAAAGATAGGGAGGGAAGGGGGAACATGAGCCTTTGTTGCTATCAATCCAAGAACTTATTTGTACATTTTTTTTTTCAATAAAACTTTTCCAATGACATTTTGTTGGAGCGTGGAAGAAGATTGGATCAGGAGATTCTTAC