Transcript asmbl_39069

Sequence
Transcript Sequence for observation asmbl_39069 of TGE0000035:
CTAATGGCTGACGCACTACGCGCAGAGGGAAAGACGGGTCACCAATAGCGACACGGATATGGCCCCGCGGGCGGGGTTTAGGCCCAAAGTGGTGTCGGAGCAGCGCCTATTAGTGTCATCCTCACCGTCACGGCCGGCGCCTCCTCCTGGATTCATTCACTCGCTCTTTTCATTCACGAAGGTAGTGAGGCCTAGTGGAAAGCCATGGAGAGCGCTCTCCCCGCCGCCGGCTTCCTGTACTGGGTCGGCGCGGGCACCGTGGCCTACCTAGCCCTGCGTATTTCGTACTCGCTCTTCACGGCCCTCCGGGTCTGGGGAGTGGGGAATGAGGCGGGGGTCGGCCCGGGGCTCGGAGAATGGGCAGTTGTCACAGGTAGTACTGATGGAATTGGAAAATCATATGCAGAAGAGTTAGCAAAGCATGGAATGAAGGTTGTCCTTATCAGCAGATCAAAGGATAAACTTGACCAGGTTTCCAGTGAAATAAAAGAAAAATTCAAAGTGGAGACAAGAACCATTGCTGTTGACTTTGCATCAGAAGATATTTATGATAAAATTAAAACAGGCTTGGCTGGTCTTGAAATCGGCATCTTAGTGAACAACGTGGGAATGTCGTATGAGTATCCTGAATACTTTTTGGATGTTCCTGACTTGGACAATGTGATCAAGAAAATGATAAATATTAATATTCTTTCTGTTTGTAAGATGACACAATTGGTACTGCCTGGCATGGTGGAAAGATCCAAAGGGGCTATTCTGAACATTTCATCTGGCAGTGGCATGCTCCCTGTCCCACTCTTGACCATCTATTCTGCAACCAAGACTTTTGTAGATTTCTTCTCTCAGTGCCTCCATGAGGAGTATAGGAGCAAGGGCGTCTTTGTGCAGAGTGTCCTGCCATACTTCGTAGCTACAAAACTGGCTAAAATCCGGAAGCCAACTTTGGATAAGCCCTCTCCGGAGACGTTTGTGAAGTCTGCAATTAAAACAGTCGGCCTGCAATCCCGAACCAATGGATACCTGATCCATGCTCTTATGGGCTCGATAATCTCAAACCTGCCTTCTTGGATTTATTTGAAAATAGTCATGAATATGAACAAGTCTACACGGGCTCACTATCTGAAGAAAACCAAGAAGAACTAAGCATTGATAACTGCATTGTAACTTGGCCAGATGCTCCAGCATATGCACGTTCACTGCAAAGCACCCTACTGGTTTTGAAAATCTGACCTTGTCATTTCAATAGTTATTAACATGACTAAATATTATCTTAATTAAGAGGAAAATAGAAGTTGCTTTTAGGGGTTTCTGACATATATTCTGGATACTATCCGAGGTAATTTTGAAGTTTAATATAAATGCTCATATCAAATGAATATAGAACTAATATTGTCGGGAACACCTAATAGAAAGGAATACTATTATAGCAAATCACAGAATGATAGACTCAAGCATAAAACTTGGCAGTTTTATCTGCTTCAAAATGCCATTGATCATTATTCCTGTATTTTCTCTGAAACTGATTATAAAAACCAATGTCCAGCTACTCTTTTGTTTTTGACACTTGAAGAAATGGAGATCGATTTGATTTGTTTATAAGCAGACACACTGCAATTTACAAAGATCTCTTTACGGTTTTATAAAATTATCTTCCAGTTTGTACATTTATATGGAATTGTTCTTTATCAAGGGTAGCTAATGACATGAAAATAATTGTGAAATATGGAATTATTTCTGACACATGAAGCCCACTAAACTATGCTTTCTTATAATGCATATTTCTTCTCAGTTTA