Transcript asmbl_30659

Sequence
Transcript Sequence for observation asmbl_30659 of TGE0056759:
CCCGCGCCCCCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCTCGGGCATAAGTAGTGCCGGAAAGTTAGCTGCCGAGACCTGGTGGATTGCTTTTCGTTTATCAGTGCAGGAAAACAGCGCTATAGTATGCGTCACAACTAGCGCAGACTCCGGCAGTATTTAGGCGGTGCGGCTTGGGAACTAGAATCCACTTCCTGTCTTCCGCCTCAGGCTAGAGGGCGAGCGCTTCGCCGTGGGACTTCTTCTGCCTGGCTCCGCCTTTTGCCCCGGAAGTACTCACAGCGGACGGTGGTTTTTGGGCCCGTTTCTGAGCAGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCGCCTAAGGACGACAAGAAGAAGAAGGACGCTGGAAAGTCGGCCAAGAAAGACAAAGACCCAGTGAACAAATCCGGGGGCAAGGCCAAAAAGAAGGTAGAAATAAGACCTCTCTGAAAGAGACTAGGGGTAACTCTCTCGTAATCCTCTAGTAATAGGTAACTTGTATAGTAAGTGGTTTTTCAGGTGTAGATTTCTAGAGTCAAAATGTGAGAGTTTATCTTCCCGTCACCACTCGTTCTTTTTCCCATTAGGATCATGAAAATGGGTCTGTTGTGCGAAGTGTCTGCCGCTGTGCCTGCTGTGTTATTTTTAACTGATCTAGTGGGGCTCGGCCCCTGTTTGAAGGCCAAAAACGTGTCGGTGTTTTTTTTTTGTTTTTGTTTTAGTAATGTGTAATTTATCCTTGATAACGGTGGAACAGATTTCTCTGACGCAGATTACTCGAGAGGGAAAGGGTGCTTCTGCCAGAAATACTAACTTGTTTCTGTTTTGTTTTGGTGAGCAGAAGTGGTCCAAAGGCAAAGTTCGGGACAAGCTCAATAACTTAGTCTTGTTTGACAAAGCTACCTATGATAAACTCTGTAAGGAAGTTCCCAACTATAAACTTATAACCCCAGCTGTGGTCTCTGAGAGACTGAAGATTCGAGGCTCCCTGGCCAGGGCAGCCCTTCAGGAGCTCCTTAGTAAAGGACTTATCAAACTGGTTTCAAAGCACAGAGCTCAAGTAATTTACACCAGAAATACCAAGGGTGGAGATGCTCCAGCTGCTGGTGAAGATGCATGAAT