Transcript asmbl_19573

Sequence
Transcript Sequence for observation asmbl_19573 of TGE0056448:
CCCCCCGGGTCGCGCGCCGCGGGCCCGAGCGCGAGACGCCGCTGCTCCCGCCCCCGCCGCCTCCTGGAGTCGCCGGGGCGGACGCGCAGTCCATGGGGCGCGGTGGGCCGGGGAGTTGCCCCAGGGGCCGCGGGAGTTGCTGAGAGGAGACAGGGTTGGGCTTTCTCCTCGCCCAGACCCCACCCCACCCTGCCGACCCCACCCCCTGCTCCTTCCTCCCCGGGGGCGCGCACTCGGGCACGCGCTCGGAAGTCGGGGGTCGGCGCGGAGTGCAGGCTGCTCCCGGGGTAGGTGAGGGAAGCGCGGAGGCGGCGCGCGGGGGCAGTGGTCGGCGAGCAGCGCGGTCCTCGCTAGGGGCGCCCACCCGTCAGTCTCTCCGGCGCGAGCCGCCGCCACCGCCCGCGCCGGAGTCAGGCCCCTGGGCCCCCAGGCTCAAGCAGCGAAGCGGCCTCCGGGGGACGCCGCTAGGCGAGAGGAACGCGCCGGTGCCCTTGCCTTCGCCGTGACCCAGCGTGCGGGCGGCGGGATGAGAGGGAGCCATCGGGCCGCGCCGGCCCTGCGGCCCCGGGGGCGGCTCTGGCCCGTGCTGGCCGTGCTGGCGGCGGCCGCCGCGGCGGGCTGTGCCCAGGCAGCCATGGACGAGTGCACGGACGAGGGCGGGCGGCCGCAGCGCTGCATGCCCGAGTTCGTCAACGCCGCCTTCAACGTGACTGTGGTGGCCACCAACACGTGTGGGACTCCGCCCGAGGAATACTGTGTGCAGACCGGGGTGACCGGGGTCACCAAGTCCTGTCACCTGTGCGACGCCGGGCAGCCCCACCTGCAGCACGGGGCAGCCTTCCTGACCGACTACAACAACCAGGCCGACACCACCTGGTGGCAAAGCCAGACCATGCTGGCCGGGGTGCAGTACCCCAGCTCCATCAACCTCACGCTGCACCTGGGAAAAGCTTTTGACATCACCTATGTGCGTCTCAAGTTCCACACCAGCCGCCCGGAGAGCTTTGCCATTTACAAGCGCACACGGGAAGACGGGCCCTGGATTCCTTACCAGTACTACAGTGGTTCCTGTGAGAACACCTACTCCAAGGCAAACCGCGGCTTCATCAGGACAGGAGGGGACGAGCAGCAGGCCTTGTGTACTGATGAATTCAGTGACATTTCTCCCCTCACTGGGGGCAACGTGGCCTTTTCTACCCTGGAAGGAAGGCCCAGCGCCTATAACTTTGACAATAGCCCTGTGCTGCAGGAATGGGTAACTGCCACTGACATCAGAGTAACTCTTAATCGCCTGAACACTTTTGGAGATGAAGTGTTTAACGATCCCAAAGTTCTCAAGTCCTATTATTATGCCATCTCTGATTTTGCTGTAGGTGGCAGATGTAAATGTAATGGACACGCAAGCGAGTGTATGAAGAACGAATTTGATAAGCTGGTGTGTAATTGCAAACATAACACATATGGAGTAGACTGTGAAAAGTGTCTTCCTTTCTTCAATGACCGGCCGTGGAGGAGGGCAACTGCGGAAAGTGCCAGTGAATGCCTGCCCTGTGATTGCAATGGTCGATCCCAGGAATGCTACTTCGACCCTGAACTCTATCGTTCCACTGGCCATGGGGGCCACTGTACCAACTGCCAGGATAACACAGATGGCGCCCACTGTGAGAGGTGCCGAGAGAACTTCTTCCGCCTTGGCAACAATGAAGCCTGCTCTTCATGCCACTGTAGTCCTGTGGGCTCTCTAAGCACACAGTGTGATAGTTACGGCAGATGCAGCTGTAAGCCAGGAGTGATGGGGGACAAATGTGACCGTTGCCAGCCTGGATTCCATTCTCTCACTGAAGCAGGATGCAGGCCATGCTCTTGTGATCCCTCTGGCAGCATAGATGAATGTAATATTGAAACAGGAAGATGTGTTTGCAAAGACAATGTCGAAGGCTTCAATTGTGAAAGATGCAAACCTGGATTTTTTAATCTGGAATCATCTAATCCTCGGGGTTGCACACCCTGCTTCTGCTTTGGGCATTCTTCTGTCTGTACAAACGCTGTTGGCTACAGTGTTTATTCTATCTCCTCTACCTTTCAGATTGATGAGGATGGGTGGCGTGCGGAACAGAGAGATGGCTCTGAAGCATCTCTCGAGTGGTCCTCTGAGAGGCAAGATATCGCCGTGATCTCAGACAGCTACTTTCCTCGGTACTTCATTGCTCCTGCAAAGTTCTTGGGCAAGCAGGTGTTGAGTTATGGTCAGAACCTCTCCTTCTCCTTTCGAGTGGACAGGCGAGATACTCGCCTCTCTGCAGAAGACCTTGTGCTTGAGGGAGCTGGCTTAAGAGTATCTGTACCCTTGATCGCTCAGGGCAATTCCTATCCAAGTGAGACCACTGTGAAGTATGTCTTCAGGCTCCATGAAGCAACAGATTACCCTTGGAGGCCTGCTCTTACCCCTTTTGAATTTCAGAAGCTCCTAAACAACTTGACCTCTATCAAGATACGTGGGACATACAGTGAGAGAAGTGCTGGATATTTGGATGATGTCACCCTGGCAAGTGCTCGTCCTGGGCCTGGAGTCCCTGCAACTTGGGTGGAGTCCTGCACCTGTCCTGTGGGATATGGAGGGCAGTTTTGTGAGATGTGCCTCTCAGGTTACAGAAGAGAAACTCCTAATCTTGGACCATACAGTCCATGTGTGCTTTGCGCCTGCAATGGACACAGCGAGACCTGTGATCCTGAGACAGGTGTTTGTAACTGCAGAGACAATACGGCTGGCCCGCACTGTGAGAAGTGCAGTGATGGGTACTATGGAGATTCAACTGCAGGCACCTCCTCCGATTGCCAACCCTGTCCGTGTCCTGGAGGTTCAAGTTGTGCTGTTGTTCCCAAGACAAAGGAGGTGGTGTGCACCAACTGTCCTACTGGCACCACTGGTAAGAGATGTGAGCTCTGTGATGATGGCTACTTTGGAGACCCCCTGGGTAGAAACGGCCCTGTGAGACTTTGCCGCCTGTGCCAGTGCAGTGACAACATCGATCCCAATGCAGTTGGAAATTGCAATCGCTTGACGGGAGAATGCCTGAAGTGCATCTATAACACTGCTGGCTTCTATTGTGACCGGTGCAAAGACGGATTTTTTGGAAATCCCCTGGCTCCCAATCCAGCAGACAAATGCAAAGCCTGCAATTGCAATCTGTATGGGACCATGAAGCAGCAGAGCAGCTGTAACCCCGTGACGGGGCAGTGTGAATGTTTGCCTCACGTGACTGGCCAGGACTGTGGTGCTTGTGACCCTGGATTCTACAATCTGCAGAGTGGGCAAGGCTGTGAGAGGTGTGACTGCCATGCCTTGGGCTCCACCAATGGGCAGTGTGACATCCGCACCGGCCAGTGTGAGTGCCAGCCCGGCATCACTGGTCAGCACTGTGAGCGCTGTGAGGTCAACCACTTTGGGTTTGGACCTGAAGGCTGCAAACCCTGTGACTGTCATCCTGAGGGATCTCTTTCACTTCAGTGCAAAGATGATGGTCGCTGTGAATGCAGAGAAGGCTTTGTGGGAAATCGCTGTGACCAGTGTGAAGAAAACTATTTCTACAATCGGTCTTGGCCTGGCTGCCAGGAATGTCCAGCTTGTTACCGGCTGGTAAAGGATAAGGTTGCTGATCATAGAGTGAAGCTCCAGGAATTAGAGAGTCTCATAGCAAACCTTGGAACTGGGGATGAGATGGTGACAGATCAAGCCTTCGAGGATAGACTAAAGGAAGCAGAGAGGGAAGTTATGGACCTCCTTCGTGAGGCCCAGGATGTCAAAGATGTTGACCAGAATTTGATGGATCGCCTACAGAGAGTGAATAACACTCTGTCCAGCCAAATTAGCCGTTTACAGAATATCCGGAATACCATTGAAGAGACTGGAAACTTGGCTGAACAAGCGCGTGCCCATGTAGAGAACACAGAGCGGTTGATTGAAATCGCATCCAGAGAACTTGAGAAAGCAAAAGTCGCTGCTGCCAATGTGTCAGTCACTCAGCCAGAATCTACAGGGGACCCAAACAACATGACTCTTTTGGCAGAAGAGGCTCGAAAGCTTGCTGAACGTCATAAACAGGAAGCTGATGACATTGTTCGAGTGGCAAAGACAGCCAATGATACGTCAACTGAGGCATACAACCTGCTTCTGAGGACACTGGCAGGAGAAAATCAAACAGCATTTGAGATTGAAGAGCTTAATAGGAAGTATGAACAAGCGAAGAACATCTCACAGGATCTGGAAAAACAAGCTGCCCGAGTACATGAGGAGGCCAAAAGGGCCGGTGACAAAGCTGTGGAGATCTATGCCAGCGTGGCTCAGCTGAGCCCTTTGGACTCTGAGACACTGGAGAATGAAGCAAATAACATAAAGATGGAAGCTGAGAATCTGGAACAACTGATTGACCAGAAATTAAAAGATTATGAGGACCTCAGAGAAGATATGAGAGGGAAGGAACTTGAAGTCAAGAACCTTCTGGAGAAAGGCAAGACTGAACAGCAGACCGCAGACCAACTCCTAGCCCGAGCTGATGCTGCCAAGGCCCTCGCTGAAGAAGCTGCAAAGAAGGGACGGGATACCTTACAAGAAGCTAATGACATTCTCAACAACCTGAAAGATTTTGATAGGCGTGTGAACGATAACAAGACGGCCGCAGAGGAGGCACTAAGGAAGATTCCTGCCATCAACCAGACCATCACTGAAGCCAATGAAAAGACCAGAGAAGCCCAGCAGGCCCTGGGCAGTGCTGCGGCGGATGCCACAGAGGCCAAGAACAAGGCCCATGAGGCGGAGAGGATCGCGAGCGCTGTCCAAAAGAATGCCACCAGCACCAAGGCAGAAGCTGAAAGAACTTTTGCAGAAGTTACAGATCTGGATAATGAGGTGAACAATATGTTGAAGCAACTGCAGGAAGCAGAAAAAGAGCTAAAGAGAAAACAAGATGACGCTGACCAGGACATGATGATGGCAGGGATGGCTTCACAGGCTGCTCAAGAAGCCGAGATCAATGCCAGAAAAGCCAAAAACTCTGTTACTAGCCTCCTCAGCATTATTAATGACCTCTTGGAGCAGCTGGGGCAGCTGGATACAGTGGACCTGAATAAGCTAAACGAGATTGAAGGCACCCTAAACAAAGCCAAAGATGAAATGAAGGTCAGCGATCTTGATAGGAAAGTGTCTGACCTGGAGAATGAAGCCAAGAAGCAGGAGGCTGCCATCATGGACTATAACCGAGATATCGAGGAGATCATGAAGGACATTCGCAATCTGGAGGACATCAGGAAGACCTTACCATCTGGCTGCTTCAACACCCCGTCCATTGAAAAGCCCTAGTGTCTTTAGGGCTGGAAGGCAGCATCCCTCTGACAGGGGGGCAGTTGTGAGGCCACAGAGTGCCTTGACACAAAGATTACATTTTTCAGACCCCCACTCCTCTGCTGCTGTCCATGACTGTCCTTTTGAACCAGGAAAAGTCACAGAGTTTAAAGAGAAGCAAATTAAACATCCTGAATCGGGAACAAAGGGTTTTATCTAATAAAGTGTCTCTTCCATTCACGTTGCTACCTTACCCACACTTTCCCTTCTGATTTGCGTGAGGACGTGGCATCCTACGTTACTGTACAGTGGCATAAGCACATCGTGTGAGCCCATGTATGCTGGGGTAGAGCAAGTAGCCCTCCCCTGTCTCATCGATACCAGCAGAACCTCCTCAGTCTCAGTACTCTTGTTTCTATGAAGGAAAAGTTTGGCTACTAACAGTAGCATTGTGATGGCCAGTATATCCAGTCCATGGATAAAGAAAATGCATCTGCATCTCCTACCCCTCTTCCTTCTAAGCAAAAGGAAATAAACATCCTGTGCCAAAGGTATTGGTCATTTAGAATGTCGGTAGCCATCCATCAGTGCTTTTAGTTATTATGAGTGTAGGACACTGAGCCATCCGTGGGTCAGGATGCAATTATTTATAAAAGTCTCCAGGTGAACATGGCTGAAGATTTTTCTAGTATATTAATAATTGACTAGGAAGATGAACTTTTTTTCAGATCTTTGGGCAGCTGATAATTTAAATCTGGATGGGCAGCTTGCACTCACCAATAGACCAAAAGACATCTTTTGATATTCTTATAAATGGAACTTACACAGAAGAAATAGGGATATGATAACCACTAAAATTTTGTTTTCAAAATCAAACTAATTCTTACAGCTTTTTTATTAGTTAGTCTTGGAACTAGTGTTAAGTATCTGGCAGAGAACAGTTAATCCCTAAGGTCTTGACAAAACAGAAGAAAAACAAGCCTCCTCGTCCTAGTCTTTTCTAGCAAAGGGATAAAACTTAGATGGCAGCTTGTACTGTCAGAATCCCGTGTATCCATTTGTTCTTCTGTTGGAGAGATGAGACATTTGACCCTTAGCTCCAGTTTTCTTCTGATGTTTCCATCTTCCAGAATCCCTCAAAAAACATTGTTTGCCAAATCCTGGTGGCAAATACTTGCACTCAGTATTTCACACAGCTGCCAACGCTATCGAGTTCCTGCACTTTGTGATTTAAATCCACTCTAAACCTTCCCTCTAAGTGTAGAGGGAAGACCCTTACGTGGAGTTTCCTAGTGGGCTTCTCAACTTTTGATCCTCAGCTCTGTGGTTTTAAGACCACAGTGTGACAGTTCCCTGCCACACACCCCCTTCCTCCTACCAACCCACCTTTGAGATTCATATATAGCCTTTAACACTATGCAACTTTGTACTTTGCGTAGCAGGGGCGGGGTGGGGGGAAAGAAACTATTATCTGACACACTGGTGCTATTAATTATTTCAAATTTATATTTTTGTGTGAATGTTTTGTGTTTTGTTTATCATGATTATAGAATAAGGAATTTATGTAAATATACTTAGTCCTATTTCTAGAATGACACTCTGTTCACTTTGCTCAATTTTTCCTCTTCACTGGCACAATGTATCTGAATACCTCCTTCCCTCCCTTCTAGAATTCTTTGGATTGTACTCCAAAGAATTGTGCCTTGTGTTTGCAGCATCTCCATTCTCTAAAATTAATATAATTGCTTTCCTCCACACCCAGCCACTGTAAAGAGGTAACTTGGGTCCTCTTCCATTGCAGTCCTGATGATCCTAACCTGCAGCACGGTGGTTTTACAATGTTCCAGAGCAGGAACGCCAGGTTGACAAGCTATGGTAGGATTAGGAAAGTTTGCTGAAGAGGATCTTTGACGCCACAGTGGGACTAGCCAGGAATGAGGGAGAAATGCCCTTTCTGGCAATTGTTGGAGCTGGATAGGTAAGTTTTATAAGGGAGTACATTTTGACTGAGCACTTAGGGCATCAGGAACAGTGCTACTTACTGATGGGTAGACTGGGAGAGGTGGTGTAACTTAGTTCTTGATGATCCCACTTCCTGTTTCCATCTGCTTGGGATATACCAGAGTTTACCACAAGTGTTTTGACGATATACTCCTGAGCTTTCACTCTGCTGCTTCTCCCAGGCCTCTTCTACTATGGCAGGAGATGTGGCGTGCTGTTGCAAAGTTTTCACGTCATTGTTTCCTGGCTAGTTCATTTCATTAAGTGGCTACATCCTAACATATGCATTTGGTCAAGGTTGCAGAAGAGGACTGAAGATTGACTGCCAAGCTAGTTTGGGTGAAGTTCACTCCAGCAAGTCTCAGGCCACAATGGGGTGGTTTGGTTTGGTTTCCTTTTAACTTTCTTTTTGTTATTTGCTTTTCTCCTCCACCTGTGTGGTATATTTTTTAAGCAGAATTTTATTTTTTAAAATAAAAGGTTCTTTACAAGATGATACCTTAATTACACTCCCGCAACACAGCCATTATTTTATTGTCTAGCTCCAGTTATCTGTATTTTATGTAATGTAATTGACAGGATGGCTGCTGCAGAATGCTGGTTGACACAGGGATTATTATACTGCTATTTTTCCCTGAATTTTTTTCCTTTGAATTCCAACTGTGGACCTTTTATATGTGCCTTCACTTTAGCTGTTTGCCTTAATCTCTACAGCCTTGCTCTCCGGGGTGGTTAATAAAATGCAACACTTGGCATTTTTATGTTTTAAGAAAAACAGTATTTTATTTATAATAAAATCTGAATATTTGTAACCCTTTATATTTGGTGTGGCCTGAGTGTGGTACTGGGGACATAAGATGTTTTAAAAGGTATAATGAATGAAAAGCCAT