Transcript asmbl_192171

Sequence
Transcript Sequence for observation asmbl_192171 of TGE0056090:
GCTGGAGAGGCGGAGGCAGCTCCAGGGGGCTGGAAGTGGAAGCGCAGCGGCAGAAGGAGAGGGAGAGAGAAAGAGAGAGAGGCTAATTAAAAAAGGATACTCCGAGGGAAGAGAGCAAGGGCGGTGCGCCGCCAAGGACCAACTAGCGGCGGAGCTTCGATCTTGCCTAGGCGCGGAGAGCTCCCAACCTGGGCTGGAACCTTGCCCAGCACAGGTGGCTGCTACACCCCATGTAAAAAGCGGAAAATAAAATGAAGATTTTCCAGCGCAAGATGCGGTACTGGTTGCTTCCACCTTTTTTGGCAATTGTTTATTTCTGCACCATTGTCCAAGGTCAAGTGGCTCCACCCACAAGGTTAAGATATAATGTAATATCTCATGACAGTATACAGATTTCATGGAAGGCTCCAAGAGGGAAATTTGGTGGTTACAAACTTCTTGTGACTCCAACTTCAGGTGGAAAAACTAACCAGCTGAATCTGCAGAACACTGCAACTAAAGCAATTATTCAAGGCCTTATGCCAGACCAGAATTACACAGTTCAAATTATTGCATACAATAAAGATAAAGAAAGCAAGCCAGCTCAAGGCCAATTCAGAATTAAAGATTTAGAAAAAAGAAAGGATCCAAAGCCCAGAGTCAAAGTTGTGGACAGAGGAAATGGGAGTAGACCATCTTCACCAGAAGAAGTGAAATTTGTCTGTCAAACTCCAGCAATTGCTGACATTGTAATCCTGGTCGATGGTTCATGGAGTATTGGAAGATTCAACTTCAGACTGGTTCGGCATTTCTTGGAAAACCTGGTTACAGCATTCGATGTGGGCTCAGAGAAGACACGAATTGGTCTTGCACAGTATAGTGGTGACCCCAGAATAGAATGGCACTTGAATGCATTTAGCACAAAAGATGAAGTGATTGAAGCTGTCCGAAACCTCCCATATAAAGGAGGAAATACACTAACAGGTCTTGCTTTGAACTACATTTTTGAAAATAGCTTCAAACCAGAAGCAGGATCAAGGACTGGAGTATCCAAAATTGGCATTTTAATCACAGATGGAAAATCCCAAGATGACATTATTCCACCATCTAGAAATCTTCGTGAGTCTGGTGTAGAACTGTTTGCCATAGGGGTGAAAAACGCGGATGTGAATGAGCTGCAGGAGATCGCCTCTGAACCAGACAGCACTCATGTGTACAATGTTGCCGAATTCGATCTGATGCACACAGTTGTGGAGAGTCTGACCAGGACTCTCTGCTCTAGAGTGGAAGAACAGGACAGAGAAATTAAAGCCTCAGCCCATGCCATCACTGGGCCGCCTACGGAGTTGATTACTTCTGAAGTCACTGCCAGAAGCTTTATGGTTAACTGGACTCATGCCCCAGGAAATGTGGAAAAATACAGAGTTGTGTATTATCCTACCAGGGGTGGAAAACCAGACGAGGTGGTGGTAGATGGAACTGTATCTTCCACAGTGTTGAAAAACTTGATGTCTTTAACTGAATATCAGATAGCAGTCTTTGCAATCTATGCCCACACTGCTAGTGAAGGCCTACGGGGAACTGAAACTACACTTGCTTTACCGATGGCTTCTGACCTTCTACTGTACGACGTGACTGAGAACAGCATGCGAGTCAAATGGGATGCAGTGCCTGGGGCCTCAGGTTACCTGATCCTTTATGCTCCTCTAACAGAGGGCCTGGCTGGGGATGAAAAAGAGATGAAAATTGGAGAGACCCACACAGATATTGAATTGAGTGGGTTGTTGCCCAATACAGAATACACAGTCACAGTTTATGCCATGTTTGGAGAAGAGGCCAGTGATCCTGTTACGGGACAAGAAACAACATTGGCTTTAAGTCCACCAAGAAACCTGAGAATCTCCAATGTTGGCTCTAACAGTGCTCGATTAACCTGGGACCCAACTTCAAGACAGATCAATGGTTATCGAATTGTATATAACAATGCAGATGGGACTGAAATCAATGAGGTTGAAGTCGATCCTATTACTACCTTCCCTCTGAAGGGCTTGACACCTCTCACAGAGTATACTATTGCTATTTTCTCCATCTATGATGAAGGACAGTCAGAGCCTCTGACTGGAGTTTTTACCACCGAGGAAGTTCCAGCCCAGCAATACTTAGAAATTGATGAGGTGACGACAGACAGTTTTAGGGTGACCTGGCATCCCCTCTCAGCTGATGAAGGGCTACACAAATTGATGTGGATTCCAGTCTATGGGGGGAAGACTGAGGAGGTTGTCCTGAAAGAAGAGCAGGACTCACATGTTATTGAAGGCCTGGAGCCCGGTACGGAGTATGAAGTTTCACTATTGGCCGTACTTGATGATGGAAGCGAGAGTGAGGTGGTGACTGCTGTCGGGACCACACTTGACAGTTTTTGGACAGAACCAGCTACAACCATAGTGCCTACCACATCTGTGACTTCAGTTTTCCAGACGGGAATCAGAAACCTAGTTGTAGGTGATGAAACTACTTCTAGCCTGCGGGTAAAATGGGACATTTCTGACAGCGATGTGCAGCAGTTTAGGGTGACCTACATGACAGCTCAAGGGGACCCTGAGGAAGAAGTCATAGGAACGGTTATGGTGCCTGGAAGCCAGAACAACCTCCTTCTGAAGCCTCTGCTTCCTGATACTGAATACAAAGTCACAGTGACTCCCATCTACACGGATGGCGAAGGCGTCAGCGTCTCCGCTCCTGGAAAAACCTTACCATCCTCGGGGCCCCAGAACTTGCGGGTGTCCGAGGAATGGTATAACCGGTTGCGCATTACGTGGGACCCCCCATCTTCCCCGGTGAAAGGCTATAGAATTGTCTACAAACCTGTCAGTGTTCCTGGTCCAACACTGGAAACGTTTGTGGGAGCTGACATTAACACCATCCTTATCACAAACCTCCTCAGCGGAATGGACTACAATGTGAAGATATTTGCCTCCCAGGCCTCAGGCTTCAGCGACGCCCTGACAGGCATGGTGAAAACATTGTTCTTGGGTGTTACCAATCTCCAAGCCAAACATGTTGAAATGACCAGCTTGTGTGCCCACTGGCAGGTACATCGCCATGCCACAGCCTATAGGGTTGTTATAGAATCCCTCCAGGATAGGCAAAAGCAAGAATCCACTGTGGGTGGAGGGACAACCAGGCATTGCTTCTATGGACTTCAGCCTGATTCTGAATATAAAATCAGTGTTTATACAAAGCTCCAGGAGATTGAAGGACCTAGTGTGAGCATAATGGAAAAAACACAATCACTTCCTACACGACCACCAACTTTTCCTCCAACCATTCCACCAGCAAAAGAAGTATGTAAGGCGGCCAAGGCTGACCTGGTATTTATGGTGGATGGATCCTGGAGCATTGGAGATGAAAATTTCAATAAGATCATCAGCTTTCTATACAGCACTGTTGGAGCCCTGAACAAGATTGGCACAGATGGAACCCAAGTTGCAATGGTTCAGTTCACTGATGATCCCAGAACAGAATTTAAACTAAATGCTTACAAAACCAAAGAGACTCTTCTTGATGCAATTAAACACATTTCATACAAAGGAGGAAATACAAAAACAGGAAAAGCAATTAAGTATGTTCGAGATACCTTGTTCACTGCAGAGTCAGGTACAAGAAGGGGCATCCCAAAGGTTATCGTGGTTATAACTGATGGAAGATCACAAGATGATGTGAACAAAATCTCCAGGGAGATGCAATTAGATGGCTATAGCATTTTTGCAATTGGTGTGGCCGATGCAGATTACTCGGAGTTGGTTAGCATTGGCAGTAAGCCCAGCGCACGCCATGTCTTCTTTGTGGATGACTTTGACGCCTTTAAGAAAATCGAAGATGAGTTAATTACTTTTGTCTGCGAAACAGCATCAGCAACCTGTCCAGTGGTACACAAGGATGGCATTGATCTTGCAGGATTTAAGATGATGGAAATGTTTGGTTTGGTTGAAAAAGATTTTTCATCAGTGGAAGGGGTTTCTATGGAGCCTGGTACCTTCAATGTGTTTCCATGTTACCAACTCCATAAAGATGCCCTGGTTTCCCAGCCAACCAGGTACTTGCACCCAGAAGGATTGCCCTCCGACTACACAATCAGTTTTCTATTCCGGATTCTTCCTGACACTCCACAGGAGCCATTTGCTCTTTGGGAGATTTTAAATAAAAATTCTGACCCATTGGTTGGGGTTATTTTAGACAATGGTGGGAAAACTCTAACATATTTCAACTATGACCAGAGTGGGGATTTTCAAACTGTTACTTTCGAAGGACCTGAAATTAGGAAAATTTTTTATGGAAGCTTTCACAAGCTACACATTGTTGTCAGTGAGACTTTGGTCAAAGTGGTTATTGACTGCAAGCAAGTGGGTGAGAAGGCAATGAACGCATCAGCTAATATCACGTCAGATGGTGTAGAAGTGCTAGGGAAAATGGTTCGATCAAGAGGACCAGGTGGAAACTCTGCACCGTTCCAGTTACAGATGTTTGATATTGTTTGCTCCACATCATGGGCCAATACAGACAAATGCTGTGAACTTCCAGGCCTGAGAGATGATGAGTCTTGCCCAGACCTTCCCCATTCCTGCTCCTGTTCTGAAACCAATGAAGTGGCTCTGGGACCAGCGGGCCCACCAGGTGGTCCAGGACTCCGAGGACCAAAGGGCCAGCAAGGTGAACCGGGTCCAAAGGGACCAGATGGCCCTCGGGGTGAAATTGGTCTGCCAGGACCTCAGGGTCCACCTGGACCTCAAGGACCAAGTGGTCTGTCCATTCAAGGAATGCCCGGAATGCCAGGAGAAAAAGGAGAGAAAGGAGATACTGGCCTTCCAGGTCCACAGGGTATCCCAGGAGGCGTTGGTTCACCAGGACGTGATGGCTCACCAGGCCAGAGGGGCCTTCCGGGAAAGGATGGATCCTCGGGACCTCCAGGACCACCAGGGCCAATAGGCATTCCTGGCACCCCTGGAGTCCCAGGGATCACAGGAAGCATGGGACCGCAAGGCGCCCTGGGACCACCTGGTGTCCCTGGAGCAAAGGGGGAACGAGGAGAGCGGGGTGACCTGCAGTCTCAAGCCATGGTGAGATCAGTGGCGCGTCAAGTATGCGAACAGCTCATCCAGAGTCACATGGCCAGGTACACTGCCATCCTCAACCAGATTCCCAGCCACTCCTCATCCATCCGGACTGTCCAAGGGCCTCCTGGGGAGCCTGGGAGGCCAGGCTCACCTGGAGCCCCTGGTGAACAAGGACCCCCAGGCACACCAGGCTTCCCCGGAAATGCAGGCGTGCCAGGGACCCCAGGAGAACGAGGTCTAACTGGTATCAAAGGAGAAAAAGGAAATCCAGGCGTTGGAACCCAAGGTCCAAGAGGCCCCCCTGGACCAGCAGGACCTTCAGGGGAGAGTCGGCCTGGCAGCCCTGGGCCCCCTGGCTCTCCTGGACCAAGAGGCCCACCAGGTCATCTGGGGGTTCCTGGACCCCAAGGTCCTTCTGGCCAGCCTGGATATTGTGACCCCTCATCATGTTCTGCCTATGGTGTGAGAGCTCCCCATCCAGATCAGCCAGAGTTCACCCCTGTCCAAGATGAGCTGGAAGCCATGGAACTGTGGGGCCCTGGAGTCTGATAGCCTCAGGAGAAATTTGAAGACCAACTGCAAGAACTCTTAAGGAATCTTGTTTGAGAAAATGTTGTTATGTGGTTTGTATGCTACTTTTGGGGGGCAGGGCTCATTTCAGCAGCCTAAATCTCCTCCTTGGATAATGTTAATATTATTATTATTATTAACAAAAAATATATATTTTTAAAAAGTTCCCTTAATCTATGACATGGTAGCAATGATTTCCCTTTGGTGTCTTAATGGCATGTCAGATAATTTGTTTTTCCAGAGAAGAGAGCTCAAAGAGGAATTGGGAAAAATAAATTGAACTCTGGAATCTTCTCTCTCAAGTCCTAAAATGAACAAACAGATATGATTGTGTTTGAGGGAAATATGTCCCTAGCAGGAAAAGAATTCAAAGAGGTTCAAAGAATATGTCACTTACTCCTACTTGCTGTAGGAATAACCTTGCTGATAAGAAAAAAAGGGACAATATTGGAGAAACTACCTCTTGTTTAATTGATCTGTCCAACTCTGAGATCACTTGGTAACTGGTTTCATGTGTATCCAAAAATCAGCATTTGGATTTAAGCTTTCTGAATTTGGTAGTTTAAGAAACAGATTTAGTTTTTCAGTGGTTTTAACTCATGTGAAATAATGATTTTCCACCAGCTCTGATGCAAAGAGATATAATTTTAATGAACGATTTATCCAGCAGTGTGTTCCAGGGGTTGCCTCTCCTTATCTACGGGGATTACTTTGTACATGCAGATAAGTTTTCGCAAACCTATTTCCATTTTCTTTTGTAAGCAAATAAAACTTTAAAACAATGTATGTGGATTCTTTTTCCTGCATTTCTAAGTATCACCTTAAGCTTTTGTAGTCTTAACTGAGTGTCCACCAGAAAGACAACAGTTGTCTTCCTTTAGGTAAGCATTCAAACTTTCATTCATTCGTTTACTCACTCACTCATTCATTCATTCTGAGTGCAGTAGAAAACAGAAGAAGCAGTTAACTTGGGACTAAGAGATTAGCGACATTTTATTGTTCATTTATAATCTAGCAGGCAGCAAAGACCCTGCAAATGCATGACCTCTGCTAAATAAATGTTTATCAATAGTTGACTGAGGAGCCCACCTATCTTCTGATATTGAGGAAAGCCTAAAAACCCCTAGAAGGCAGAGCAGAAATGAGGTTGAATCTAATAGACTCTAACCCTTAAACCATACTTTGTCTTTTGCTCACAAAGGAAAAATCTAGGTATTTGAGAAAGATTTGAATTCTATTATGTGCTAGTTGAAATAGAAACAAAAGAGAACCATAAATTTAATACGTGCTCCTTCTCTGTAACATCTCCCTAGTAACAGCTAACTTTAGAAAGTAGGGATGGGATCATTTACAACTAGAAGCTGGATTCTTTCTGGATCAGGAAAAGGCTAACACGAAGGATGGTGTCTGTCTGATCACCAGGTTCTCTTTCTGTCCTTCTCATAATCTCCTGATCTTTGGAGATGAAAGATCTCCTTTCATCTTCATCTGAAGGATTCTTCAGATGATTCATCTTCAGACTTCATCTGAAGGATTCAAACAATCTACTTGTGTGCCTTTGG