Transcript asmbl_27149

Sequence
Transcript Sequence for observation asmbl_27149 of TGE0000975:
GGGGTTGGTGGCCAGGGCGACCGCGGGGCGGGCCAGCGCCGGGGGTCGTGGCCGGGACACGTGGTACGGAACCGGCGCCGCGCTTGCTGCTGGTAACAGGGCCTTGCCTAGTGGGCCTTCCTTCCCAGGTCGCCCCTCAGTCTCCACTAGAGACAGGACTGACCAGTTGCTCTTCCTTCCAAGAACCTTCGAGATCTGCGGTCTGGGGTCTGGTTGAAAGATGGCGGCCCTCACTACCCTGTTTAAGTACATAGATGAAAATCAGGATCGCTACATTAAGAAACTCGCAAAATGGGTGGCTATCCAGAGTGTGTCTGCGTGGCCGGAGAAGAGAGGCGAAATCAGGAGGATGATGGAAGTTGCTGCTGCAGATGTTAAGCAGTTGGGGGGCTCTGTGGAACTGGTGGATATCGGAAAACAAAAGCTCCCTGATGGCTCGGAGATCCCGCTCCCTCCTATTCTGCTCGGCAGGCTGGGCTCCGACCCACAGAAGAAGACCGTGTGCATTTACGGGCACCTGGATGTGCAGCCTGCAGCCCTGGAGGACGGCTGGGACAGCGAGCCCTTCACCCTGGTGGAGCGAGACGGCAAGCTGTATGGGAGAGGTTCGACTGATGATAAGGGCCCGGTGGCCGGCTGGATAAACGCCCTGGAAGCGTATCAGAAAACAGGCCAGGAGATTCCTGTCAACGTCCGATTCTGCCTCGAAGGCATGGAGGAGTCAGGCTCTGAGGGCCTAGACGAGCTGATTTTTGCCCGGAAAGACACATTCTTTAAGGATGTGGACTATGTCTGCATTTCTGACAATTACTGGCTGGGAAAGAAGAAGCCCTGCATCACCTACGGCCTCAGGGGCATTTGCTACTTTTTCATCGAGGTGGAGTGCAGCAACAAAGACCTCCATTCTGGGGTGTACGGGGGCTCGGTGCATGAGGCCATGACTGATCTCATTTTGCTGATGGGCTCTTTGGTGGACAAGAGGGGGAACATCCTGATCCCCGGCATTAACGAGGCCGTGGCCGCCGTCACGGAAGAGGAGCACAAGCTGTACGACGACATCGACTTTGACATAGAGGAGTTTGCCAAGGATGTGGGGGCGCAGATCCTCCTGCACAGCCACAAGAAAGACATCCTCATGCACCGATGGCGGTACCCGTCTCTGTCCCTCCATGGCATCGAAGGCGCCTTCTCTGGGTCTGGGGCCAAGACCGTGATTCCCAGGAAGGTGGTTGGCAAGTTCTCCATCAGGCTCGTGCCGAACATGACTCCTGAAGTCGTCGGCGAGCAGGTCACAAGCTACCTAACTAAGAAGTTTGCTGAACTACGCAGCCCCAATGAGTTCAAGGTGTACATGGGCCACGGTGGGAAGCCCTGGGTCTCCGACTTCAGTCACCCTCATTACCTGGCTGGGAGAAGAGCCATGAAGACAGTTTTTGGTGTTGAGCCAGACTTGACCAGGGAAGGCGGCAGTATTCCCGTGACCTTGACCTTTCAGGAGGCCACGGGCAAGAACGTCATGCTGCTGCCTGTGGGGTCAGCGGATGACGGAGCCCACTCCCAGAATGAAAAGCTCAACAGGTATAACTACATAGAGGGAACCAAGATGCTGGCCGCGTACCTGTATGAGGTCTCCCAGCTGAAGGACTAGGCCAAGCCCTCTGTGTGCCATCTCCAATGAGAAGGAATCCTGCCCTCACCTCACCCTTTTCCAACTTGCCCAGGGAAGTGGAGGTTCCCTCTTTCCTTTCCCTCTTGTCAGGTCATCCATGACTTTAGAGAACAGACACAAGTGTATCCAGCTGTCCACGGGTGGAGCTACCCGTTGGGCTTATGAGTGACCTGGAGTGACAGCTGAGTCACCCTGGGTAAGTTCTCAGAGTGGTCAGGATGGCTTGACCTGCAGAAGATACCCAAGGTCCAAAAGCACAAGGTCTGCGGAAAGTTCTGGTTGTCGGCCGGGCACCACGGCTCACACCTATAATCGAGCACTTTGGGAGGCCAAGACAGGAGGATCACTTGAGGCCAGGAGTCTGAGACAAGCCTAGGCAACA