Transcript asmbl_16676

Sequence
Transcript Sequence for observation asmbl_16676 of TGE0056385:
CGGAAGTAAGGGTGAGAGGAGGCTGCAACGCCGAGCGGAGGAGGCAGGAACCGGAGCGCGAGCAGTAGCTGGGTGGGCACCATGGCTGGGATCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATGCAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAACAGGCTGAGGCTGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCCCGTTGCCGAGAGATGGATGAGCAGATTAGACTGATGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGTACTCTCAAAAAGAAGATAAATATGAGGAAGAAATCAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAGATAAACTGAAATGCACCAAAGAGGAGCACCTCTGTACACAAAGGATGCTGGACCAGACCCTGCTTGACCTGAATGAGATGTAGAACGCCCCAGTCCCACCCTGCTGCTGCTCCTCCCTCTGACCCAGACTCCGCCTGAGGCCAGCCTGCGGGAAGCTGACCTTTAACTGAGGGCTGATCTTTAACTGGAAGGCTGCTTTCTCCTTTCACCACCCCCTCCTTCCCTGTGTCTTTTTCGCCAAACTGTCTCTGCCTCTTCCCGGAGAATCCAGCTGGGCTAGAGGCTGAGCACCTTTGGAAACAACATTTAAGGGAATGTGAGCACAATGCATAATGTCTTTAAAAAGCATGTTGTGATGTACACATTTTGTAATTACCTTTTTTGTTGTTTTGTAGCAACCATTTGTAAAACATTCCAAATAATTCCACAGTCCTGAAGCAGCAATCGAATCCCTTTCTCACTTTTGGAAGGTGACTTTTCACCTTAATGCATATTCCCCTCTCCATAGAGGAGAGGAAAAGGTGTAGGCCTGCCTTACCGAGAGCCAAACAGAGCCCAGGGAGACTCCGCTGTGGGAAACCTCATTGTTCTGTACAAAGTACTAGCTAAACCAGAAAGGTGATTCCAGGAGGAGTTAGCCAAACAACAACAAAAACAAAAAATGTGCTGTTCAAGTTTTCAGCTTTAAGATATCTTTGGATAATGTTATTTCTATTTTTTATTTTTTTCATTAGAAGTTACCAAATTAAGATGGTAAGACCTCTGAGACCAAAATTTTGTCCCATCTCTACCCCCTCACAACTGCTTACAGAATGGATCATGTCCCCCTTATGTTGAGGTGACCACTTAATTGCTTTCCTGCCTCCTTGAAAGAAAGAAAGAAAGAAGACTGTGTTTTTGCCACTGATTTAGCCATGTGAAACTCATCTCATTACCCTTTTCTGGGTTTGAAGCTGCTGTCTCTAGAAGTGCCATCTCAATTGTGCTTTGTATCAGTCAGTGCTGGAGAAATCTTGAATAGCTTATGTACAAAACTTTTTAAATTTTATATTATTTTGAAACTTTGCTTTGGGTTTGTGGCACCCTGGCCACCCCATCTGGCTGTGACAGCCTCTGCAGTCCGTGGGCTGGCAGTTTGTTGATCTTTTAAGTTTCCTTCCCTACCCAGTCCCCATTTTCTGGTAAGGTTTCTAGGAGGTCTGTTAGGTGTACATCCTGCAGCTTATTGGCTTAAAATGTACTCTCCTTTTATGTGGTCTCTTTGGGGCCGATTGGGAGAAAGAGAAATCAATAGTGCAACTGTTTTGATACTGAATATTGACAAGTGTCTTTTTGAAATAAAGAACCAGTCCCTCCAACCCTCAGACCTATTTGACTTTTATTTATTAAAACTAAATGTGCTTTCTCC