Transcript asmbl_15463

Sequence
Transcript Sequence for observation asmbl_15463 of TGE0057110:
CCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGGCACAAGCGCGGGGGCAGCCTCCCGGCCCGGCACCAGACCCATGGCTCCCAGCTGCGGCTCCACCTCGTCTCCCCTGCCGACTCAGGCGAGTATGTGTGTCGTGCAGCCAGCGGCCCAGGCCCTGAGCAAGAAGCCTCCTTCACAGTCACCGTCCCGCCCAGTGAGGGGTCTTCCTACCGCCTTAGGAGCCCGGTCATCTCCATCGACCCGCCCAGCAGCACCGTGCAGCAGGGCCAGGATGCCAGCTTCAAGTGCCTCATCCATGACGGGGCAGCCCCCATCAGCCTCGAGTGGAAGACCCGGAACCAGGAGCTGGAGGACAACGTCCACATCAGTCCCAATGGCTCCATCATCACCATCGTGGGCACCCGGCCCAGCAACCACGGTACCTACCGCTGCGTGGCCTCCAATGCCTACGGTGTGGCCCAGAGTGTGGTGAACCTCAGTGTGCACGGGCCCCCTACAGTGTCCGTGCTCCCCGAGGGCCCCGTGTGGGTGAAAGTGGGAAAGGCTGTCACCCTGGAGTGTGTCAGTGCCGGGGAGCCCCGCTCCTCTGCTCGTTGGACCCGGATCAGCAGCACCCCTGCCAAGTTGGAGCAGCGGACATATGGGCTCATGGACAGCCACGCGGTGCTGCAGATTTCATCAGCTAAACCATCAGATGCGGGCACTTATGTGTGCCTTGCTCAGAATGCACTAGGCACAGCACAGAAGCAGGTGGAGGTGATCGTGGACACGGGCGCCATGGCCCCAGGGGCCCCTCAGGTCCAAGCTGAAGAAGCTGAGCTGACTGTGGAGGCTGGACACACGGCCACCTTGCGCTGCTCAGCCACAGGCAGCCCCGCGCCCACCATCCACTGGTCCAAGCTGCGTTCCCCACTGCCCTGGCAGCACCGGCTGGAAGGTGACACACTCATCATACCCCGGGTAGCCCAGCAGGACTCGGGCCAGTACATCTGCAATGCCACTAGCCCTGCTGGGCACGCTGAGGCCACCATCATCCTGCACGTGGAGAGCCCACCATATGCCACCACGGTCCCAGAGCACGCTTCGGTGCAGGCAGGGGAGACGGTGCAGCTCCAGTGCCTGGCTCACGGGACACCCCCACTCACCTTCCAGTGGAGCCGCGTGGGCAGCAGCCTTCCTGGGAGGGCGACCGCCAGGAACGAGCTGCTGCACTTTGAGCGTGCAGCCCCTGAGGACTCAGGCCGCTACCGCTGCCGGGTCACCAACAAGGTGGGCTCAGCCGAGGCCTTTGCCCAGCTGCTCGTCCAAGGCCCTCCCGGCTCTCTCCCTGCCACCTCCATCCCAGCAGGGTCCACGCCCACCGTGCAGGTCACGCCTCAGCTAGAGACCAAGAGCATTGGGGCCAGCGTTGAGTTCCACTGTGCTGTGCCCAGCGACCGGGGTACCCAGCTCCGTTGGTTCAAGGAAGGGGGTCAGCTGCCTCCGGGTCACAGCGTGCAGGATGGGGTGCTCCGAATCCAGAACTTGGACCAGAGCTGCCAAGGGACGTATATATGCCAGGCCCATGGACCTTGGGGGAAGGCCCAGGCCAGTGCCCAGCTGGTTATCCAAGCCCTGCCCTCGGTGCTCATCAACATCCGGACCTCTGTGCAGACCGTGGTGGTTGGCCACGCCGTGGAGTTCGAATGCCTGGCACTGGGTGACCCCAAGCCTCAGGTGACATGGAGCAAAGTTGGAGGGCACCTGCGGCCAGGCATTGTGCAGAGCGGAGGTGTCGTCAGGATCGCCCACGTAGAGCTGGCTGATGCGGGACAGTATCGCTGCACTGCCACCAACGCAGCTGGCACCACACAATCCCACGTCCTGCTGCTTGTGCAAGCCTTGCCCCAGATCTCAATGCCCCAAGAAGTCCGTGTGCCTGCTGGTTCTGCAGCTGTCTTCCCCTGCATAGCCTCAGGCTACCCCACTCCTGACATCAGCTGGAGCAAGCTGGATGGCAGCCTGCCACCTGACAGCCGCCTGGAGAACAACATGCTGATGCTGCCCTCAGTCCGACCCCAGGACGCAGGTACCTACGTCTGCACCGCCACTAACCGCCAGGGCAAGGTCAAAGCCTTTGCCCACCTGCAGGTGCCAGAGCGGGTGGTGCCCTACTTCACGCAGACCCCCTACTCCTTCCTACCGCTGCCCACCATCAAGGATGCCTACAGGAAGTTCGAGATCAAGATCACCTTCCGGCCCGACTCAGCCGATGGGATGCTGCTGTACAATGGGCAGAAGCGAGTCCCAGGGAGCCCCACCAACCTGGCCAACCGGCAGCCCGACTTCATCTCCTTCGGCCTCGTGGGGGGAAGGCCCGAGTTCCGGTTCGATGCAGGCTCAGGCATGGCCACCATCCGCCATCCCACACCACTGGCCCTGGGCCATTTCCACACCGTGACCCTGCTGCGCAGCCTCACCCAGGGCTCCCTGATTGTGGGTGACCTGGCCCCGGTCAATGGGACCTCCCAGGGCAAGTTCCAGGGCCTGGATCTGAACGAGGAACTCTACCTGGGTGGCTATCCTGACTATGGTGCCATCCCCAAGGCGGGGCTGAGCAGCGGCTTCATAGGCTGTGTCCGGGAGCTGCGCATCCAGGGCGAGGAGATCGTCTTCCATGACCTCAACCTCACGGCGCACGGCATCTCCCACTGCCCCACCTGTCGGGACCGGCCCTGCCAGAATGGCGGTCAGTGCCATGACTCTGAGAGCAGCAGCTACGTGTGCGTCTGCCCAGCTGGCTTCACCGGGAGCCGCTGTGAGCACTCGCAGGCCCTGCACTGCCATCCAGAGGCCTGTGGGCCCGACGCCACCTGTGTGAACCGGCCTGACGGTCGAGGCTACACCTGCCGCTGCCACCTGGGCCGCTCGGGGTTGCGGTGTGAGGAAGGTGTGACAGTGACCACCCCCTCGCTGTCGGGTGCTGGCTCCTACCTGGCACTGCCCGCCCTCACCAACACACACCACGAGCTACGCCTGGACGTGGAGTTCAAGCCACTCGCCCCTGACGGGGTCCTGCTGTTCAGCGGGGGGAAGAGCGGGCCTGTGGAGGACTTCGTGTCCCTGGCGATGGTGGGCGGCCACCTGGAGTTCCGCTATGAGTTGGGGTCAGGGCTGGCCGTTCTGCGGAGCGCCGAGCCGCTGGCCCTGGGCCGCTGGCACCGTGTGTCTGCAGAGCGTCTCAACAAGGACGGCAGCCTGCGGGTGAATGGTGGACGCCCTGTGCTGCGCTCCTCGCCCGGCAAGAGCCAGGGCCTCAACCTGCACACCCTGCTCTACCTGGGGGGTGTGGAGCCTTCCGTGCCACTGTCCCCGGCCACCAACATGAGCGCTCACTTCCGCGGCTGTGTGGGCGAGGTGTCAGTGAATGGCAAACGGCTGGACCTCACCTACAGTTTCCTAGGCAGCCAGGGCATCGGGCAATGCTATGATAGCTCCCCATGTGAGCGCCAGCCTTGCCAACATGGTGCCACGTGCATGCCCGCTGGCGAGTATGAGTTCCAGTGCCTGTGTCGAGATGGATTCAAAGGAGACCTGTGTGAGCACGAGGAGAACCCCTGCCAGCTCCGTGAACCCTGTCTGCATGGGGGCACCTGCCAGGGCACCCGCTGCCTCTGCCTCCCTGGCTTCTCTGGCCCACGCTGCCAACAAGGCTCTGGACATGGCATAGCAGAGTCCGACTGGCATCTTGAAGGCAGCGGGGGCAATGATGCCCCTGGGCAGTACGGAGCCTATTTCCACGATGATGGCTTCCTCGCCTTCCCTGGCCATGTCTTCTCCAGGAGCCTGCCCGAGGTGCCCGAGACCATCGAGCTGGAGGTTCGGACCAGCACAGCCAGTGGCCTCCTGCTCTGGCAGGGTGTGGAGGTGGGAGAGGCCGGCCAAGGCAAGGACTTCATCAGCCTCGGGCTTCAAGACGGGCACCTTGTCTTCAGGTACCAGCTGGGTAGTGGGGAGGCCCGCCTGGTCTCTGAGGACCCCATCAATGACGGCGAGTGGCACCGGGTGACAGCACTGCGGGAGGGCCGCAGAGGTTCCATCCAAGTCGACGGTGAGGAGCTGGTCAGCGGCCGGTCCCCAGGTCCCAACGTGGCAGTCAACGCCAAGGGCAGCGTCTACATCGGCGGAGCCCCTGACGTGGCCACGCTGACCGGGGGCAGATTCTCCTCAGGCATCACAGGCTGTGTCAAGAACCTGGTGCTGCACTCGGCCCGACCCGGCGCCCCGCCCCCACAGCCCCTGGACCTGCAGCACCGCGCCCAGGCCGGGGCCAACACACGCCCCTGCCCCTCGTAGGCACCTGCCTGCCCCACACGGACTCCCGGGCCACGCCCCAGCCCGACAATGTCGAGTATATTATTATTAATATTATTATGAATTTTTGTAAGAAACCGAGGCGATGCCACGCTTTGCTGCTACCGCCCTGGGCTGGACTGGAGGTGGGCATGCCACCCTCACACACACAGCTGGGCAAAGCCACAAGGCTGGCCAGCAAGGCAGGTTGGATGGGAGTGGGCACCTCAGAAAGTCACCAGGACTTGGGGTCAGGAACAGTGGCTGGGTGGGCCCAGAACTGCCCCCACTGTCCCCCTACCCACCGATGGAGCCCCCAGATAGAGCTGGGTGGCCTGTTTCTGCAGCCCTTGGGCAGTTCTCACTCCTAGGAGAGCCAACCTCGGCTTGTGGGCTGGTGCCCCACAGCTACCTGAGACGGGCATCGCAGGAGTCTCTGCCACCCACTCAGGATTGGGAATTGTCTTTAGTGCCGGCTGTGGAGCAAAAGGCAGCTCACCCCTGGGCAGGCGGTCCCCATCCCCACCAGCTCGTTTTTCAGCACCCCCACCCACCTCCACCCAGCCCCTGGCACCTCCTCTGGCAGACTCCCCCTCCTACCACGTCCTCCTGGCCTGCATTCCCACCCCCTCCTGCCAGCACACAGCCTGGGGTCCCTCCCTCAGGGGCTGTAAGGGAAGGCCCACCCCAACTCTTACCAGGAGCTGCTACAGGCAGAGCCCAGCACTGATAGGGCCCCGCCCACCGGGCCCCGCCCACCCCAGGCCACATCCCCACCCATCTGGAAGTGAAGGCCCAGGGACTCCTCCAACAGACAACGGACGGACGGATGCCGCTGGTGCTCAGGAAGAGCTAGTGCCTTAGGTGGGGGAAGGCAGGACTCACGACTGAGAGAGAGAGGAGGGGGATATGACCACCCTGCCCCATCTGCAGGAGCCTGAAGATCCAGCTCAAGTGCCATCCTGCCAGTGGCCCCCAGACTGTGGGGTTGGGACGCCTGGCCTCTGTGTCCTAGAAGGGACCCTCCTGTGGTCTTTGTCTTGATTTTTCTTAATAAACGGTGCTATCCCCGCCAGGGGCCTCCTGAGTCTTTGATGAGGGCTTCACTCAGTGGAGCCTGTGGATGGGGCAGAGCAGGGCAGGTGAGATCTGGGGGTGAAGCAAGCTGGCTTGGGATCAGCGAGGCCCCCAGGCCCCCAACCCTGTGAGGCAGGAATTGTCCTATTTTCTAGAGGGGCAGCTGAGTCTCAGAGGGTTAGGGGGCCTGTCCAACATCAGACAGAGAGCCAGGGGGTTAGAACCCAAAGAGTCTGACCCCAGAGCCTAGTATCATTCCCATGTGCCCGAAGCCCCTCTAGGGATGGCCTCCCTGATCCTATAAGGCTGGGCCACTCAACTGCAGCCCCCTGGGGAGACCTGGCTGGGACATGGGTAGCACGTGGTACAGGCTGTGCTGCAGTGGAGGCAGAGGCCACGGGCACCAGGTTGCCAGGCCAGCCAGCTGGGAGAGCAACAGCACCAGAGGAGGCCCAGGAGGAGGCCAGCAGAGGCCAGGAGCATCGAGGAGGCCAGCGCCACCCCTCAGAGCTGGGGGCCTGTGGGAAGAGAAAGTCCACTCAGGCCTCGGCCTGGGTCCTCTGCCCCGTCCCCATCACCTAGAGAGGGACAGGTATGATTTTGGTGGGAAGAGTAGGAGCAAGGTGTAACCTTCCAAAGCTGCGTCTTGTCTCGTGGGGTCCCTGCCTGCTGGGGAACTCCTCTCAGCTGCAATCCAGAGGGATCCTGCAGACCCGAGAGCTGGGGAGGGAGTCAGGGATCTGGAGGTATGGGCATCTGTACTTCCTGTCTGGCTGGGCACCGGAGAGGGACCTGCATGGGAAAGAACAGAACTAGCACACTGAGAACTGCCCTTTCTGGGACACTTGTGTGTTTCATTCAATCCTCACAAGACTTCCCTGAGTTTGTCACTCTGTGTTTCCATTTTACAGAGAGGTTGTCACTTGCCGAGTTCAATTAGCTGGAAGTGATAGGAGGACTTGAACTCACATGGTCTGGCTCCAGGGCCTAAGGTCTATGAGTGGAGCTACTTCCCAAGGAAGAGGGTGTACATGTACTGAGCATTGAGGCAGGGTCTCACTCTGTCGCCCAGGCTGGAGT