Transcript asmbl_126096

Sequence
Transcript Sequence for observation asmbl_126096 of TGE0056330:
CTCTCACTCTGGCTGGGAGCAGAAGGCAGCCTCGGTCTCTGGGCGGCGGCGGCGGCCCACTCTGCCCTGGCCGCGCTGTGTGGTGACCGCAGGCCCCAGACATGAGGGCGGCCCGTGCTCTGCTGCCCCTGCTGCTGCAGGCCTGCTGGACAGCCGCGCAGGATGAGCCGGAGACCCCGAGGGCCGTGGCCTTCCAGGACTGCCCCGTGGACCTGTTCTTTGTGCTGGACACCTCTGAGAGCGTGGCCCTGAGGCTGAAGCCCTACGGGGCCCTCGTGGACAAAGTCAAGTCCTTCACCAAGCGCTTCATCGACAACCTGAGGGACAGGTACTACCGCTGTGACCGAAACCTGGTGTGGAACGCAGGCGCGCTGCACTACAGTGACGAGGTGGAGATCATCCAAGGCCTCACGCGCATGCCTGGCGGCCGCGACGCACTCAAAAGCAGCGTGGACGCGGTCAAGTACTTTGGGAAGGGCACCTACACCGACTGCGCTATCAAGAAGGGGCTGGAGCAGCTCCTCGTGGGGGGCTCCCACCTGAAGGAGAATAAGTACCTGATTGTGGTGACCGACGGGCACCCCCTGGAGGGCTACAAGGAACCCTGTGGGGGGCTGGAGGATGCTGTGAACGAGGCCAAGCACCTGGGCGTCAAAGTCTTCTCGGTGGCCATCACACCCGACCACCTGGAGCCGCGTCTGAGCATCATCGCCACGGACCACACGTACCGGCGCAACTTCACGGCGGCTGACTGGGGCCAGAGCCGCGACGCAGAGGAGGCCATCAGCCAGACCATCGACACCATCGTGGACATGATCAAAAATAACGTGGAGCAAGTGTGCTGCTCCTTCGAATGCCAGCCTGCAAGAGGACCTCCGGGGCTCCGGGGCGACCCCGGCTTTGAGGGAGAACGAGGCAAGCCGGGGCTCCCAGGAGAGAAGGGAGAAGCCGGAGATCCTGGAAGACCCGGGGACCTCGGACCTGTTGGGTACCAGGGAATGAAGGGAGAAAAAGGGAGCCGTGGGGAGAAGGGCTCCAGGGGACCCAAGGGCTACAAGGGAGAGAAGGGCAAGCGTGGCATCGACGGGGTGGACGGCGTGAAGGGGGAGATGGGGTACCCAGGCCTGCCAGGCTGCAAGGGCTCGCCCGGGTTTGACGGCATTCAAGGACCCCCTGGCCCCAAGGGAGACCCCGGTGCCTTTGGACTGAAAGGAGAAAAGGGCGAGCCTGGAGCTGACGGGGAGGCGGGGAGACCAGGGAGCTCGGGACCATCTGGAGACGAGGGCCAGCCGGGAGAGCCTGGGCCCCCCGGAGAGAAAGGAGAGGCGGGCGACGAGGGGAACCCAGGACCTGACGGTGCCCCCGGGGAGCGGGGTGGCCCTGGAGAGAGAGGACCACGGGGGACCCCAGGCACGCGGGGACCAAGAGGAGACCCTGGTGAAGCTGGCCCGCAGGGTGATCAGGGAAGAGAAGGCCCCGTTGGTGTCCCTGGAGACCCGGGCGAGGCTGGCCCTATCGGACCTAAAGGCTACCGAGGCGATGAGGGTCCCCCAGGGTCCGAGGGTGCCAGAGGAGCCCCAGGACCTGCCGGACCCCCTGGAGACCCGGGGCTGATGGGTGAAAGGGGAGAAGACGGCCCCGCTGGAAATGGCACCGAGGGCTTCCCCGGCTTCCCCGGGTATCCGGGCAACAGGGGCGCTCCCGGGATAAACGGCACGAAGGGCTACCCCGGCCTCAAGGGGGACGAGGGAGAAGCCGGGGACCCCGGAGACGATAACAACGACATTGCACCCCGAGGAGTCAAAGGAGCAAAGGGGTACCGGGGTCCCGAGGGCCCCCAGGGACCCCCAGGACACCAAGGACCGCCTGGGCCGGACGAATGCGAGATTTTGGACATCATCATGAAAATGTGCTCTTGCTGTGGTGAGACCCAGGCTCTAGCTCCTGAGAGAATGGATCCCGGGGGTCGGGGAGCGAGGCCTGGGTCCCACACATGTCACAGGACAGCACATGGCACTCTGGTCCCCGCCCGCAGCTCCCTGCACCTGCCCGCCCCCTCTGGGGCCTGCTCCAAGCCAGCAGGGTTCCCGGGTGTTGGGCTGGGCCCCGCCCTCTTTCACCCATAACTGAAATAACCAGGAGCAGGCTTGGGGGGGTCCCTGCTCCATCATTCTGGCCCACAGGCCCCACCCTAGCCTGGCTGAGCAACGCCAGCCCTGACCAGCCGCCGGACAGAGCAGCCTTTACGGGGCCATGGG