Transcript asmbl_104809

Sequence
Transcript Sequence for observation asmbl_104809 of TGE0001397:
GGCAGTGTTCACCTAGTAACCCCTTCCGGATAAGGACCTGCAGCCCGGGCGCGACCCGGAAAGGGAATCCGCCCTTTTCGCCTCCTTCGCGCCAATCGCCTGGAGTTGGCGTTTCCGCAGCCGGGACACAGCCCACCCTCTAAGAGCCGCGGAGTCGGGGACGGTAGAAGGGGCCGCGCGTGCGCAGTGGCGTCCGCTGTGCTTCCGGTGCGCCGGGCGCGGACGCGGGCACGCACACACGCAAGCACGCCTCCACTTAACTCGCGCCGCCGCGGCAGCTCGAGTCCACCAGCAGCGCCGTCCGCTTGACCGAGATGCTGCGGGCCTGTCAGTTATCGGGTGTGACCGCCGCCGCCCAGAGTTGTCTCTGTGGGAAGTTTGTCCTCCGTCCATTGCGACCATGCCGCAGATACTCTACTTCAGGCAGCTCTGGGTTGACTACTGGCAAAATTGCTGGAGCTGGCCTTTTGTTTGTTGGTGGAGGTATTGGTGGCACTATCCTATATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATACCTTACTCAGACAAACTCTTCGAGATGGTTCTTGGTCCTGCAGCTTATAATGTTCCATTGCCAAAGAAATCGATTCAGTCGGGTCCACTAAAAATCTCTAGTGTATCAGAAGTAATGAAAGAATCTAAACAGCCTGCCTCACAACTCCAAAAACAAAAGGGAGATACTCCAGCTTCAGCAACAGCACCTACAGAAGCGGCTCAAATTATTTCTGCAGCAGGTGATACCCTGTCGGTCCCAGCCCCTGCAGTTCAGCCTGAGGAATCTTTAAAAACTGATCACCCTGAAATTGGTGAAGGAAAACCCACACCTGCACTTTCAGAAGAAGCATCCTCATCTTCTATAAGGGAGCGACCACCTGAAGAAGTTGCAGCTCGCCTTGCACAACAGGAAAAACAAGAACAAGTTAAAATTGAGTCTCTAGCCAAGAGCTTAGAAGATGCTCTGAGGCAAACTGCAAGTGTCACTCTGCAGGCTATTGCAGCTCAGAATGCTGCGGTCCAGGCTGTCAATGCACACTCCAACATATTGAAAGCCGCCATGGACAATTCTGAGATTGCAGGCGAGAAGAAATCTGCTCAGTGGCGCACAGTGGAGGGTGCATTGAAGGAACGCAGAAAGGCAGTAGATGAAGCTGCCGATGCCCTTCTCAAAGCCAAAGAAGAGTTAGAGAAGATGAAAAGTGTGATTGAAAATGCAAAGAAAAAAGAGGTTGCTGGGGCCAAGCCTCATATAACTGCTGCAGAGGGTAAACTTCACAACATGATAGTTGATCTGGATAATGTGGTCAAAAAGGTCCAAGCAGCTCAGTCTGAGGCTAAGGTTGTATCTCAGTATCATGAGCTGGTGGTCCAAGCTCGGGATGACTTTAAACGAGAGCTGGACAGTATTACTCCAGAAGTCCTTCCTGGGTGGAAAGGAATGAGTGAGTACAACTGAACTGACAAGCTCTCTACTGATGATCTGAACTCCCTCATTGCTCATGCACATCGTCGTATTGATCAGCTGAACAGAGAGCTGGCAGAACAGAAGGCCACCGAAAAGCAGCACATCACGTTAGCCTTGGAGAAACAAAAGCTGGAAGAAAAGCGGGCATTTGACTCTGCAGTAGCAAAAGCATTAGAACATCACAGAAGTGAAATACAGGCTGAACAGGACAGAAAGATAGAAGAAGTCAGAGATGCCATGGAAAATGAAATGAGAACCCAGCTTCGCCGACAGGCAGCTGCCCACACTGATCACTTGCGAGATGTCCTTAGGGTACAAGAACAGGAATTGAAGTCTGAATTTGAGCAGAACCTGTCTGAGAAACTCTCTGAACAAGAATTACAATTTCGTCGTCTCAGTCAAGAGCAAGTTGACAACTTTACTCTGGATATAAATACTGCCTATGCCAGACTCAGAGGAATCGAACAGGCTGTTCAGAGCCATGCAGTTGCTGAAGAGGAAGCCAGAAAAGCCCACCAACTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAACACCTACTATCCCGCTGGGTAGTGCAGTTGAGGCCATCAAAGCCAACTGTTCTGATAATGAATTCACCCAAGCTTTAACCGCAGCTATCCCTCCAGAGTCCCTGACCCGTGGGGTGTACAGTGAAGAGACCCTTAGAGCCCGTTTCTATGCTGTTCAAAAACTGGCCCGAAGGGTAGCAATGATTGATGAAACCAGAAATAGCTTGTACCAGTACTTCCTCTCCTACCTACAGTCCCTGCTCCTATTCCCACCTCAGCAACTGAAGCCGCCCCCAGAGCTCTGCCCTGAGGATATAAACACATTTAAATTACTGTCATATGCTTCCTATTGCATTGAGCATGGTGATCTGGAGCTAGCAGCAAAGTTTGTCAATCAGCTGAAGGGGGAATCCAGACGAGTGGCACAGGACTGGCTGAAGGAAGCCCGAATGACCCTAGAAACGAAACAGATAGTGGAAATCCTGACAGCATATGCCAGCGCCGTAGGAATAGGAACCACTCAGGTGCAGCCAGAGTGAGGTTTAGGAAGATTTTCATAAAGTCATATTTCATGTCAAAGGAAATCAGCAGTGATAGATGAAGGGTTCGCAGCGAGAGTCCCGGACTTGTCTAGAAATGAGCAGGTTTACAAGTACTGTTCTAAATGTTAACACCTGTTGCATTTATATTCTTTCCATTTGCTATCATGTCAGTGAACGCCAGGAGTGCTTTCTTTGCAACTTGTGTAACATTTTCTGTTTTTTCAGGTTTTACTGATGAGGCTTGTGAGGCCAATCAAAATAATGTTTGTGATCTCTACTACTGTTGATTTTGCCCTCGGAGCAAACTGAATAAAGCAACAAGATGAAAACTGA