Transcript asmbl_104808

Sequence
Transcript Sequence for observation asmbl_104808 of TGE0001397:
GGCAGTGTTCACCTAGTAACCCCTTCCGGATAAGGACCTGCAGCCCGGGCGCGACCCGGAAAGGGAATCCGCCCTTTTCGCCTCCTTCGCGCCAATCGCCTGGAGTTGGCGTTTCCGCAGCCGGGACACAGCCCACCCTCTAAGAGCCGCGGAGTCGGGGACGGTAGAAGGGGCCGCGCGTGCGCAGTGGCGTCCGCTGTGCTTCCGGTGCGCCGGGCGCGGACGCGGGCACGCACACACGCAAGCACGCCTCCACTTAACTCGCGCCGCCGCGGCAGCTCGAGTCCACCAGCAGCGCCGTCCGCTTGACCGAGATGCTGCGGGCCTGTCAGTTATCGGGTGTGACCGCCGCCGCCCAGAGTTGTCTCTGTGGGAAGTTTGTCCTCCGTCCATTGCGACCATGCCGCAGATACTCTACTTCAGGCAGCTCTGGGTTGACTACTGGCAAAATTGCTGGAGCTGGCCTTTTGTTTGTTGGTGGAGGTATTGGTGGCACTATCCTATATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATACCTTACTCAGACAAACTCTTCGAGATGGTTCTTGGTCCTGCAGCTTATAATGTTCCATTGCCAAAGAAATCGATTCAGTCGGGTCCACTAAAAATCTCTAGTGTATCAGAAGTAATGAAAGAATCTAAACAGCCTGCCTCACAACTCCAAAAACAAAAGGGAGATACTCCAGCTTCAGCAACAGCAGGTGATACCCTGTCGGTCCCAGCCCCTGCAGTTCAGCCTGAGGAATCTTTAAAAACTGATCACCCTGAAATTGGTGAAGGAAAACCCACACCTGCACTTTCAGAAGAAGCATCCTCATCTTCTATAAGGGAGCGACCACCTGAAGAAGTTGCAGCTCGCCTTGCACAACAGGAAAAACAAGAACAAGTTAAAATTGAGTCTCTAGCCAAGAGCTTAGAAGATGCTCTGAGGCAAACTGCAAGTGTCACTCTGCAGGCTATTGCAGCTCAGAATGCTGCGGTCCAGGCTGTCAATGCACACTCCAACATATTGAAAGCCGCCATGGACAATTCTGAGATTGCAGGCGAGAAGAAATCTGCTCAGTGGCGCACAGTGGAGGGTGCATTGAAGGAACGCAGAAAGGCAGTAGATGAAGCTGCCGATGCCCTTCTCAAAGCCAAAGAAGAGTTAGAGAAGATGAAAAGTGTGATTGAAAATGCAAAGAAAAAAGAGGTTGCTGGGGCCAAGCCTCATATAACTGCTGCAGAGGGTAAACTTCACAACATGATAGTTGATCTGGATAATGTGGTCAAAAAGGTCCAAGCAGCTCAGTCTGAGGCTAAGGTTGTATCTCAGTATCATGAGCTGGTGGTCCAAGCTCGGGATGACTTTAAACGAGAGCTGGACAGTATTACTCCAGAAGTCCTTCCTGGGTGGAAAGGAATGAGTGAGTACAACTGAACTGACAAGCTCTCTACTGATGATCTGAACTCCCTCATTGCTCATGCACATCGTCGTATTGATCAGCTGAACAGAGAGCTGGCAGAACAGAAGGCCACCGAAAAGCAGCACATCACGTTAGCCTTGGAGAAACAAAAGCTGGAAGAAAAGCGGGCATTTGACTCTGCAGTAGCAAAAGCATTAGAACATCACAGAAGTGAAATACAGGCTGAACAGGACAGAAAGATAGAAGAAGTCAGAGATGCCATGGAAAATGAAATGAGAACCCAGCTTCGCCGACAGGCAGCTGCCCACACTGATCACTTGCGAGATGTCCTTAGGGTACAAGAACAGGAATTGAAGTCTGAATTTGAGCAGAACCTGTCTGAGAAACTCTCTGAACAAGAATTACAATTTCGTCGTCTCAGTCAAGAGCAAGTTGACAACTTTACTCTGGATATAAATACTGCCTATGCCAGACTCAGAGGAATCGAACAGGCTGTTCAGAGCCATGCAGTTGCTGAAGAGGAAGCCAGAAAAGCCCACCAACTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAACACCTACTATCCCGCTGGGTAGTGCAGTTGAGGCCATCAAAGCCAACTGTTCTGATAATGAATTCACCCAAGCTTTAACCGCAGCTATCCCTCCAGAGTCCCTGACCCGTGGGGTGTACAGTGAAGAGACCCTTAGAGCCCGTTTCTATGCTGTTCAAAAACTGGCCCGAAGGGTAGCAATGATTGATGAAACCAGAAATAGCTTGTACCAGTACTTCCTCTCCTACCTACAGTCCCTGCTCCTATTCCCACCTCAGCAACTGAAGCCGCCCCCAGAGCTCTGCCCTGAGGATATAAACACATTTAAATTACTGTCATATGCTTCCTATTGCATTGAGCATGGTGATCTGGAGCTAGCAGCAAAGTTTGTCAATCAGCTGAAGGGGGAATCCAGACGAGTGGCACAGGACTGGCTGAAGGAAGCCCGAATGACCCTAGAAACGAAACAGATAGTGGAAATCCTGACAGCATATGCCAGCGCCGTAGGAATAGGAACCACTCAGGTGCAGCCAGAGTGAGGTTTAGGAAGATTTTCATAAAGTCATATTTCATGTCAAAGGAAATCAGCAGTGATAGATGAAGGGTTCGCAGCGAGAGTCCCGGACTTGTCTAGAAATGAGCAGGTTTACAAGTACTGTTCTAAATGTTAACACCTGTTGCATTTATATTCTTTCCATTTGCTATCATGTCAGTGAACGCCAGGAGTGCTTTCTTTGCAACTTGTGTAACATTTTCTGTTTTTTCAGGTTTTACTGATGAGGCTTGTGAGGCCAATCAAAATAATGTTTGTGATCTCTACTACTGTTGATTTTGCCCTCGGAGCAAACTGAATAAAGCAACAAGATGAAAACTGA