Transcript asmbl_103774

Sequence
Transcript Sequence for observation asmbl_103774 of TGE0058238:
GAATCTGCGCGAGCTCGGCGGGAATCTGCGCAAGCTCGGCGGGAATCTGCGCATGCTCAGAGTTCCGGGGCACGGTTTCCCCGCCCCTTTCAGGCCTAGCAGGAAACGAAGCGGCTCTTTCCGCTATCTGCCGCTTGTCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGGCTTTACCATGAGTAACTCCATTCCTGGTATAGAATCCCCATTTGAACAAGCAAAGAAGGTGATAACCATGTTTGTACAGCGACAGGTGTTTGCTGAGAACAAGGATGAGATTGCTTTAGTCCTGTTTGGTACAGATGGCACTGACAATCCCCTTTCTGGTGGGGATCAGTATCAGAACATCACAGTGCACAGACATCTGATGCTACCAGATTTTGATTTGCTGGAGGACATTGAAAGCAAAATCCAACCAGGTTCTCAACAGGCTGACTTCCTGGATGCACTAATCGTGAGCATGGATGTGATTCAACATGAAACAATAGGAAAGAAGTTTGAGAAGAGGCATATTGAAATATTCACTGACCTCAGCAGCCGATTCAGCAAAAGTCAGCTGGATATTATAATTCATAGCTTGAAGAAATGTGACATCTCCCTGCAATTCTTCTTGCCTTTCTCACTTGGCAAGGAAGATGGAAGTGGGGACAGAGGAGATGGCCCCTTTCGCTTAGGTGGCCATGGGCCTTCCTTTCCACTAAAAGGAATTACCGAACAGCAAAAAGAAGGTCTTGAGATAGTGAAAATGGTGATGATATCTTTAGAAGGTGAAGATGGGTTGGATGAAATTTATTCATTCAGTGAGAGTCTGAGAAAACTGTGCGTCTTCAAGAAAATTGAGAGGCATTCCATTCACTGGCCCTGCCGACTGACCATTGGCTCCAATTTGTCTATAAGGATTGCAGCCTATAAATCGATTCTACAGGAGAGAGTTAAAAAGACTTGGACAGTTGTGGATGCAAAAACCCTAAAAAAAGAAGATATACAAAAAGAAACAGTTTATTGCTTAAATGATGATGATGAAACTGAAGTTTTAAAAGAGGATATTATTCAAGGGTTCCGCTATGGAAGTGATATAGTTCCTTTCTCTAAAGTGGATGAGGAACAAATGAAATATAAATCGGAGGGGAAGTGCTTCTCTGTTTTGGGATTTTGTAAATCTTCTCAGGTTCAGAGAAGATTCTTCATGGGAAATCAAGTTCTAAAGGTCTTTGCAGCAAGAGATGATGAGGCAGCTGCAGTTGCACTTTCCTCCCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAGTCGGCGTGGCTTTTCCTCATATCAAGCATAACTATGAGTGTTTAGTGTATGTGCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCACCGAGGCACAGTTGAATGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAGAAAGATGAGAAGACAGACACCCTTGAAGACTTGTTTCCAACCACCAAAATCCCAAATCCTCGATTTCAGAGATTATTTCAGTGTCTGCTGCACAGAGCTTTACATCCCCGGGAGCCTCTACCCCCAATTCAGCAGCATATTTGGAATATGCTGAATCCTCCCGCTGAGGTGACAACAAAAAGTCAGATTCCTCTCTCTAAAATAAAGACCCTTTTTCCTCTGATTGAAGCCAAGAAAAAGGATCAAGTGACTGCTCAGGAAATTTTCCAAGACAACCATGAAGATGGACCTACAGCTAAAAAATTAAAGACTGAGCAAGGGGGAGCCCACTTCAGCGTCTCCAGTCTGGCTGAAGGCAGTGTCACCTCTGTTGGAAGTGTGAATCCTGCTGAAAACTTCCGTGTTCTAGTGAAACAGAAGAAGGCCAGCTTTGAGGAAGCGAGTAACCAGCTCATAAATCACATCGAACAGTTTTTGGATACTAATGAAACACCGTATTTTATGAAGAGCATAGACTGCATCCGAGCCTTCCGGGAAGAAGCCATTAAGTTTTCAGAAGAGCAGCGCTTTAACAACTTCCTGAAAGCCCTTCAAGAGAAAGTGGAAATTAAACAATTAAATCATTTCTGGGAAATTGTTGTCCAGGATGGAATTACTCTGATCACCAAAGAGGAAGCCTCTGGAAGTTCTGTCACAGCTGAGGAAGCCAAAAAGTTTCTGGCCCCCAAAGACAAACCAAGTGGAGACACAGCAGCTGTATTTGAAGAAGGTGGTGATGTGGACGATTTATTGGACATGATATAGGTCGTGGATGTATGGGGAATCTAAGAGAGCTGCCATCGCTGTGATGCTGGGAGTTCTAACAAAACAAGTTGGATGCGGCCATTCAAGGGGAGCCAAAATCTCAAGAAATTCCCAGCAGGTTACCTGGAGGCGGATCATCTAATTCTCTGTGGAATGAATACACACATATATATTACAAGGGATAATTTAGACCCCATACAAGTTTATAAAGAGTCATTGTTATTTTCTGGTTGGTGTATTATTTTTTCTGTGGTCTTACTGATCTTTGTATATTACATACATGCTTTGAAGTTTCTGGAAAGTAGATCTTTTCTTGACCTAGTATATCAGTGACAGTTGCAGCCCTTGTGATGTGATTAGTGTCTCATGTGGAACCATGGCATGGTTATTGATGAGTTTCTTAACCCTTTCCAGAGTCCTCCTTTGCCTGATCCTCCAACAGCTGTCACAACTTGTGTTGAGCAAGCAGTAGCATTTGCTTCCTCCCAACAAGCAGCTGGGTTAGGAAAACCATGGGTAAGGACGGACTCACTTCTCTTTTTAGTTGAGGCCTTCTAGTTACCACATTACTCTGCCTCTGTATATAGGTGGTTTTCTTTAAGTGGGGTGGGAAGGGGAGCACAATTTCCCTTCATACTCCTTTTAAGCAGTGAGTTATGGTGGTGGTCTCATGAAGAAAAGACCTTTTGGCCCAATCTCTGCCATATCAGTGAACCTTTAGAAACTCAAAAACTGAGAAATTTACTACAGTAGTTAGAATTATATCACTTCACTGTTCTCTACTTGCAAGCCTCAAAGAGAGAAAGTTTCGTTATATTAAAACACTTAGGTAACTTTTCGGTCTTTCCCATTTCTACCTAAGTCAGCTTTCATCTTTGTGGATGGTGTCTCCTTTACTAAATAAGAAAATAACAAAGCCCTTATTCTCTTTTTTTCTTGTCCTCATTCTTGCCTTGAGTTCCAGTTCCTCTTTGGTGTACAGACTTCTTGGTACCCAGTCACCTCTGTCTTCAGCACCCTCATAAGTCGTCACTAATACACAGTTTTGTACATGTAACATTAAAGGCATAAATGACTCATCTCTCTGTGAATTGCTGCTAATTATTGTCTGCAAAAGACTTCTTCAGTGCTCTGCTGAGAATTGAACACCCTTATCCATTGATTGAAAATGGATCTGCAAGATAGAACATCATTCATTTAGCTGAGGAGAGAAAGGAGTGCTTTACTTTGGGCTTCTAGGACATCCTCTCAATACTATACACACTTGCATCAAACTTGACATACAGGTGCTCATTTAAAGTAACCCCAACAGAGGATGACATATAGTTTCTGGTTAGATAGTTAAAGCCCAGGGGTTGTTTGTGACTTGGACAAAACTGAGACATTCTTAGAACCACAGAGAGTGGAAACTTTGATCTCTGAAATCTTCATTATTCTCATCAGATCCTCCCAGCAATATGAATCAGCTCAGTAAGTATGGCTCCATCAGCAGCCCCTGTCTTTGGCAGTTTGGGGAATTTCTTTTGGGAAACGTCAGTCTTTTTGTCATGCCAGGAAAAGTTTAAATCAAGTTAGTCCTTTAGATCTTCTGATACTTTTTGACTTAGTTTGAATGCAGCAGGATTATTTGTGCTTCTCTAACCCTGTTTTACCTAAATCTCAATACCTCAAGGAAGAAATTAGTTTCACAGGCTAAGGAGAGGAAGAACTAAATGAGTCATGTAATTTCCAAATCCATTTCATACAGGTGAAGTATATGTGCTATGTAGACTTCATCAGAGCGTACTGTTTTGAGTAGGGACAGCGTGTTTTGCATGAACACATCACAGTCCCATTTCCGTGAAATGAGATTGGCAGATCTACAGAACTCCCAGGTGTTCTGCTGAGTGTAGCCCTGGAGGACAGCAAGTGCTGTATTGTCGTCAATCCACCATGGGCTGCTTCTCAGAAGCCCAGTAATCCCACAAATGATAGGCTTGTCTGTGATTGCAAGTCACTGACTATGGACCCGGTC