Transcript asmbl_94712

Sequence
Transcript Sequence for observation asmbl_94712 of TGE0061287:
ATTGCGGTGTGCGCCCTGCACTCTGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCCGCCGCCCCGCAGAAATGCTTCGGTTACCCACAGTCTTTCGCCAGATGAGACCGGTGTCCAGGGTACTGGCTCCTCATCTCACTCGGGCTTATGCCAAAGATGTAAAATTTGGTGCAGATGCCCGAGCCTTAATGCTTCAAGGTGTAGACCTTTTAGCCGATGCTGTGGCCGTTACAATGGGGCCAAAGGGAAGAACAGTGATTATTGAGCAGAGTTGGGGAAGTCCCAAAGTAACAAAAGATGGTGTGACTGTTGCAAAGTCAATTGACTTAAAAGATAAATACAAAAACATTGGAGCTAAACTTGTTCAAGATGTTGCCAATAACACAAATGAAGAAGCTGGGGATGGCACTACCACTGCTACTGTACTGGCACGCTCTATAGCCAAGGAAGGCTTCGAGAAGATTAGCAAAGGTGCTAATCCAGTGGAAATCAGGAGAGGTGTGATGTTAGCTGTTGATGCTGTAATTGCTGAACTTAAAAAGCAGTCTAAACCTGTGACCACCCCTGAAGAAATTGCACAGGTTGCTACGATTTCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAGAGGGATTGACCCTGAATCTTGAAGACGTTCAGCCTCATGACTTAGGAAAAGTTGGAGAGGTCATTGTGACCAAAGACGATGCCATGCTCTTAAAAGGAAAAGGTGACAAGGCTCAAATTGAAAAACGTATTCAAGAAATCATTGAGCAGTTAGATGTCACAACTAGTGAATATGAAAAGGAAAAACTGAATGAACGGCTTGCAAAACTTTCAGATGGAGTGGCTGTGCTGAAGGTTGGTGGGACAAGTGATGTTGAAGTGAATGAAAAGAAAGACAGAGTTACAGATGCCCTTAATGCTACAAGAGCTGCTGTTGAAGAAGGCATTGTTTTGGGAGGGGGTTGTGCCCTCCTTCGATGCATTCCAGCCTTGGACTCATTGACTCCAGCTAATGAAGATCAAAAAATTGGTATAGAAATTATTAAAAGAACACTCAAAATTCCAGCAATGACCATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATAGTTGAGAAAATTATGCAAAGTTCCTCAGAAGTTGGTTATGATGCTATGGCTGGAGATTTTGTGAATATGGTGGAAAAAGGAATCATTGACCCAACAAAGGTTGTGAGAACTGCTTTATTGGATGCTGCTGGTGTGGCCTCTCTGTTAACTACAGCAGAAGTTGTAGTCACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCAATGGGTGGAATGGGAGGTGGTATGGGAGGTGGCATGTTCTAACTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGACAGGAAGCCCAAGGCAGTGTTCCTCACCAATAACTTCAGAGAAGTCAGTTGGAGAAAATGAAGAAAAAGGCTGGCTGAAAATCACTATAACCATCAGTTACTGGTTTCAGTTGACAAAATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAAAACATTTGTACATTCCTGATACTGGGTACAAGAGCCATGTACCAGTGTACTGCTTTCAACTTAAATCACTGAGGCATTTTTACTACTATTCTGTTAAAATCAGGATTTTAGTGCTTGCCACCACCAGATGAGAAGTTAAGCAGCCTTTCTGTGGAGAGTGAGAATAATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAAATTTGTTTAAAGTTAATAATTGTGTTAGCATTTCCATGATTAGAAGATACTGAAAATTGAAAGCCAGTTGAAGGGCAGGCTGGCATGTGTGTAAAACATTATCCTATCTATGATATTTTCATGTTTCTCTTTGTTGCAGACTGAACTACATTATTCCATTGATAATGGGGAAAGACAGTTTCTATTTTCCCCGGTGCAAGGATGTAATCTCTCTTGGAGCTGTAAAATCTGGGAGGTTGGAGGGAACTCCAGCTCCTCAGCATGGCCTTTGGGCTGCTGCTGCAAGCAAGGCATTGAGGCAAATATTTTTGCTGTCCTTACCTTGGACAGAAGTAGAGGGGAGAAATAAAGTCCATCATCACATGAAAAGTCAGTCACTTGAAATCCTGTACCTAGAATACCTTTGGCTTTGGTAATTTCGTTGTGTTTGGGGTACAAAAAAAAGGATCTATTTGATAGCACAACGGGGTGACTATAGTCAATAATAATTGTACATTTAAAAATAAAAGAATGTAATTGGATTGTAACAAAGGATAAATGGTTGAGGGGTGATGATGATCACCCCTCCATTTCCATGATATGATTCTCCATGATA