Transcript asmbl_93378

Sequence
Transcript Sequence for observation asmbl_93378 of TGE0057062:
CCTCGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCTGTACCTTCTTTCTGGCAGTGAATGGTCTGTATTCCTCTAGTGATGATGTGATCGAATTAACTCCATCGAATTTCAACCGAGAAGTTATTCAGAGTGATAGTTTGTGGCTTGTAGAATTCTATGCTCCATGGTGTGGTCACTGTCAAAGATTAACACCAGAATGGAAGAAAGCAGCAACTGCATTAAAAGATGTTGTCAAAGTTGGTGCAGTTGATGCAGATAAGCATCATTCCCTAGGAGGTCAGTATGGTGTTCAGGGATTTCCTACCATTAAGATTTTTGGATCCAACAAAAACAGACCAGAAGATTACCAAGGTGGCAGAACTGGTGAAGCCATTGTAGATGCTGCGCTGAGTGCTCTGCGCCAGCTCGTGAAGGATCGCCTCGGGGGACGGAGCGGAGGATACAGTTCTGGAAAACAAGGCAGAAGTGATAGTTCAAGTAAGAAGGATGTGATTGAGCTGACAGACGACAGCTTTGATAAGAATGTTCTGGACAGTGAAGATGTTTGGATGGTTGAGTTCTATGCTCCTTGGTGTGGACACTGCAAAAACCTAGAGCCAGAGTGGGCTGCCGCAGCTTCAGAAGTAAAAGAGCAGACGAAAGGAAAAGTGAAACTGGCAGCTGTGGATGCTACAGTCAATCAGGTTCTGGCCTCCCGATACGGGATTAGAGGATTTCCTACAATCAAGATATTTCAGAAAGGCGAGTCTCCTGTGGATTATGACGGTGGGCGGACAAGATCCGACATCGTGTCCCGGGCCCTTGATTTGTTTTCTGATAACGCCCCACCTCCTGAGCTGCTTGAGATTATCAACGAGGACATTGCCAAGAGGACGTGTGAGGAGCACCAGCTCTGTGTTGTGGCTGTGCTGCCCCATATCCTTGATACTGGAGCTGCAGGCAGAAATTCTTATCTGGAAGTTCTTCTGAAGTTGGCAGACAAATACAAAAAGAAAATGTGGGGGTGGCTGTGGACAGAAGCTGGAGCCCAGTCTGAACTTGAGACCGCGTTGGGGATTGGAGGGTTTGGGTACCCCGCCATGGCCGCCATCAATGCACGCAAGATGAAATTTGCTCTGCTAAAAGGCTCCTTCAGTGAGCAAGGCATCAACGAGTTTCTCAGGGAGCTCTCTTTTGGGCGTGGCTCCACGGCACCTGTAGGAGGCGGGGCTTTCCCTACCATCGTTGAGAGAGAGCCTTGGGACGGCAGGGATGGCGAGCTTCCCGTGGAGGATGACATTGACCTCAGTGATGTGGAGCTTGATGACTTAGGGAAAGATGAGTTGTGAGAGCCACAACAGAGGCTTCAGACCATTTTCTTTTCTTGGGAGCCAGTGGATTTTTCCAGCAGTGAAGGGACATTCTCTACACTCAGATGACTCTACCAGTGGCCTTTTAACCAAGAAGTAGTACTTGATTGGTCATTTGAAAACACTGCAACAGTGAACTTTTGCATCTCAAGAAAACATTGAAAAATTCTATGAATTGTTGTAGCCGGTGAATTGAGTCGTATTCTGTCACATAATATTTTGAAGAAAACTTGGCTGTCGAAACATTTTTCTCTCTGACTGCTGCTTGAATGTTCTTGGAGGCTGTTTCTTATGTATGGGTTTTTTTTAATGTGATCCCTTCATTTGAATATTAATGGCTTTTTCCATTAAAGAATAAAATATTTTGGACAATGCCGATAAATGTATGAAGTTAGTATCCACATCATAAATTCAGAGTGATGTTTAGCAGTAAATCAATATTTTGAAGTGATACACAGATGTCTTTCCTCCCCACAAACTTTTTTAAACAAAAAACAAGACCTCTTTTCTTTAGATGGTGCCACCTATGCCCACCACAACAGAGATTTTACATGGAAACCGGGCTCAGTGAGAACTGATTTCCTGCCCAATATTTGTCTTTGGGCTGTCTCTAGTGACTAATTATTAAGGAATCTAGCTGGTTATACAGTTCAAGGCTTTCTATGTTGTTAATGAACCTCAAAATAGCCGTTAAGACATGAAATACAGCAGCAGGTTACCAATGCGAACAGGTAGTTCGCATTTATGTAAAACATTCAGAAAATGAAGTTTTGAATTTGTTGGAACATTCAAAGGACTTGAGAGCATTTTATTGTAACTTAAAAAAATAAATACAACTGTCACT