Transcript asmbl_92952

Sequence
Transcript Sequence for observation asmbl_92952 of TGE0061285:
AATAGACACAGTTTCTAACCCCAGGGAGGTCACACAGTCTGGTGGGGACATAGACTTCAAGGGTGTGGCTCCTGGGCAGAGATTGGGCCACTTCCTGTGCCCTCCCTGGGTGGGTGGGGCCTCTCCACTCCCTGTCTCTCCTGCCTCTACCCAGCAGCCAGGCCCTCCCGCTCTGTCCTGGACCCACCCCCTGGTCAGCCCCCGGCCAGTCGTTTCCACTGCCAGCTTTATCACCCGCAACTGTCTGTCTTTCTGTCTGTCCCACCCAGGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGCAGATGCGGGAATTGGAGGACCGATTTGCCAGTGAGGCCAGTGGCTACCAGGACAACATTGCGCGCCTGGAGGAGGAAATCCGGCACCTCAAGGATGAGATGGCCCGCCATCTGCGCGAGTACCAGGACCTGCTCAACGTGAAGATGGCCCTGGATGTGGAGATTGCCACCTACCGGAAGCTGCTGGAGGGAGAGGAGAGCCGGATCAATCTCCCCATCCAGACCTACTCTGCCCTCAACTTCCGAGAAACCAGCCCTGAGCAAAGGGGTTCTGAGGTCCATACCAAGAAGACGGTGATGATCAAGACCATCGAGACACGGGATGGGGAGGTCGTCAGTGAGGCCACACAGCAGCAGCATGAAGTGCTCTAAAGACAGAGACCCTCTGCCACCAGAGACCGTCCTCACCCCTGTCCTCACTGCTCCCTGAAGCCAGCCTTCTTCCATCCCAGGACACCACACCCAGCCTCAGTCCTCCCCTCACAGCCTCTGACCCCTCCTCACTGGCCATCCCTCGTGGTCCCCAACAGCGACATAGCCCATCCCTGCCTGGTCACAGGGCATGCCCCGGCCACCTCTGCGGACCCCAGCTGTGAGCCTTGGCTGTTGGCAGTGAGTGAGCCTGGCTCTTGTGCTGGATGGAGCCCAGGCGGGAGCGGTGGCCCTGTCCCTCCCACCTCTGTGACCTCAGGCACTAGCCTTTGGCTCTGGAGACAGCCCCAGAGCAGGGTGTTGGGATACTGCAGGGCCAGGACTGAGCCCCGCAGACCTCCCCAGCCCCTAGCCCAGGAGAGAGAAAGCCAGGCAGGTAGCCAGGGGGACTAGCCCCTGTGGAGACTGGGGGGCTTGAAATTGTCCCCGTGGTCTCTTACTTTCCTTTCCCCAGCCCAGGGTGGACTTAGAAAGCAGGGGCTACAAGAGGGAATCCCCGAAGGTGCTGGAGGTGGGAGCAGGAGATTGAGAAGGAGAGAAAGTGGGTGAGATGCTGGAGAAGAGAGGAGAGGAGAGAGGCAGAGAGCGGTCTCAGGCTGGTGGGAGGGGCGCCCACCTCCCCACGCCCTCCCCTCCCCTGCTGCAGGGGCTCTGGAGAGAAACAATAAAGAGATTCACACACAAGCCAAGCTGGCCCCTGTTGTCTTGACTGCCAGGTCTCCTGTGGGGCCCCTGGGGCCCTGTGATACAACCTGTCACCCTGAGATGGACTATACTGACCTTCTACCCAGCCAGACTTTCCCCAGGGCCTCGCGCCCACTTCTGTTCCCAGAGCCACCTGGCCTTGATGTCTGTATGCAGTGTATGGGGCAGGGAGGGCTGGACAGGGCTTTTGTTGGGGAACCACAAATACCTCTCGTTAGGCCCCAGTTCCAGGACTGCACCCCTTGTGCTCTCTACTACACCTTCAGGTCAGCCAGGCTGGGGGACACCACCTGCTATTCCTTTTGAAGGATGTAGCTGCTCCCCACTGACTGGCTCTGAAGTAGGGCTCCCCCAGTCCCTTCTTCAAAGATGCCAACAGCCCCTTTTTTTTCTCTCTCTCTTTTTTTCTTTTTGAGATGGAGTCTTGCTGTGTCACCCAGGCTGGAGTGCAGTGGTGCGATCTCGGCTCACTGCAAGCTCCGCCTCCTGGGTTCACGCCATTCTCCTGTCTCAGCCTCCCGAGTAGCTGGGACTACAGGCACCCACCACCACGCCCGGCTAAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCGTGTTAGCCAGGAT