Transcript asmbl_77421

Sequence
Transcript Sequence for observation asmbl_77421 of TGE0056073:
GATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAGCACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACTCAGGTGAGGCTCGGCCGACGCCCGTGCTCCTCCCGTCCTTTCCCCAGTCATTTTCTGCCCGGCTTGATTTCTGACATTTAAGTGTTTCTTTCGCTGTTCCAGGCTCTGTTCCTCTCCCGGCATTTCCTCCCTGAAGCCTCCAGGTTTCTCATTTGGTTTCTGCCTGCGTTCTTTTCTTTTCTCCACACATCACACTGGCATGCAGCATGTTGTGGCGTGTGAGCATGGGGTGGCCGTGGGTCTCTGTCCCTGACTAAGCCGCCCCTTGTCCCTTCTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAAACGGACTCAGCAGATGCGTAGCATTTGCTGCATGGGTTAATTGAGAATAGAAATTTGCCCCTGGCAAATGCACACACCTCATGCTAGCCTCACGAAACTGGAATAAGCCTTCGAAAAGAAATTGTCCTTGAAGCTTGTATCTGATATCAGCACTGGATTGTAGAACTTGTTGCTGATTTTGACCTTGTATTGAAGTTAACTGTTCCCCTTGGTATTTGTTTAATACCCTGTACATATCTTTGAGTTCAACCTTTAGTACGTGTGGCTTGGTCACTTCGTGGCTAAGGTAAGAACGTGCTTGTGGAAGACAAGTCTGTGGCTTGGTGAGTCTGTGTGGCCAGCAGCCTCTGATCTGTGCAGGGTATTAACGTGTCAGGGCTGAGTGTTCTGGGATTTCTCTAGAGGCTGGCAAGAACCAGTTGTTTTGTCTTGCGGGTCTGTCAGGGTTGGAAAGTCCAAGCCGTAGGACCCAGTTTCCTTTCTTAGCTGATGTCTTTGGCCAGAACACCGTGGGCTGTTACTTGCTTTGAGTTGGAAGCGGTTTGCATTTACGCCTGTAAATGTATTCATTCTTAATTTATGTAAGGTTTTTTTTGTACGCAATTCTCGATTCTTTGAAGAGATGACAACAAATTTTGGTTTTCTACTGTTATGTGAGAACATTAGGCCCCAGCAACACGTCATTGTGTAAGGAAAAATAAAAGTGCTGCCGTAACCAA