Transcript asmbl_55902

Sequence
Transcript Sequence for observation asmbl_55902 of TGE0056539:
CAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGTGTACTCCGAAAAGGGGGAGTCATCTGGCAAAAATGTCACTTTGCCTGCTGTATTCAAGGCTCCTATTCGACCAGATATTGTGAACTTTGTTCACACCAACTTGCGCAAAAACAACAGACAGCCCTATGCTGTCAGTGAATTAGCAGGTCATCAGACTAGTGCTGAGTCTTGGGGTACTGGCAGAGCTGTGGCTCGAATTCCCAGAGTTCGAGGTGGTGGGACTCACCGCTCTGGCCAGGGTGCTTTTGGAAACATGTGTCGTGGAGGCCGAATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCATCGTAGAGTGAACACAACCCAAAAACGATACGCCATCTGTTCTGCCCTGGCTGCCTCAGCCCTACCAGCACTGGTCATGTCTAAAGGTCATCGTATTGAGGAAGTTCCTGAACTTCCTTTGGTAGTTGAAGATAAAGTTGAAGGCTACAAGAAGACCAAGGAAGCTGTTTTGCTCCTTAAGAAACTTAAAGCCTGGAATGATATCAAAAAGGTCTATGCCTCTCAGCGAATGAGAGCTGGCAAAGGCAAAATGAGAAACCGTCGCCGTATCCAGCGCAGGGGCCCGTGCATCATCTATAATGAGGATAATGGTATCATCAAGGCCTTCAGAAACATCCCTGGAATTACTCTGCTTAATGTAAGCAAGCTGAACATTTTGAAGCTTGCTCCTGGTGGGCATGTGGGACGTTTCTGCATTTGGACTGAAAGTGCTTTCCGGAAGTTAGATGAATTGTACGGCACTTGGCGTAAAGCCGCTTCCCTCAAGAGTAACTACAATCTTCCCATGCACAAGATGATTAATACAGATCTTAGCAGAATCTTGAAAAGCCCAGAGATCCAAAGAGCCCTTCGAGCACCACGCAAGAAGATCCATCGCAGAGTCCTAAAGAAGAACCCACTGAAAAACTTGAGAATCATGTTGAAGCTAAACCCATATGCAAAGACCATGCGCCGGAACACCATTCTTCGCCAGGCCAGGAATCACAAGCTCCGGGTGGATAAGGCAGCTGCTGCAGCAGCGGCACTACAAGCCAAATCAGATGAGAAGGCGGCGGTTGCAGGCAAGAAGCCTGTGGTAGGTAAGAAAGGAAAGAAGGCTGCTGTTGGTGTTAAGAAGCAGAAGAAGCCTCTGGTGGGAAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAGAGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATTTGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACCTGATTATACAGGCAGTGAGAAACATGACTTGGTGTGCTCTGTAAAGCTTGGTTAGAATTTTTTTAAAGTGACATTTTGTTGGCCATAATTTAGACTGTTACATTTTATATAGTGTGGTATAAAATGGGGCATGGATTTATACTAAGTCCATGGAGTTCAGTGGAAGGGGAATGATTTAAAAAAAGTTGTGGTTTTCTAAATAATGTGGCTTGAAAAATAGGTGTAACAGGACTTGGTCAGAAACGCAGAGGCTGTTCAAGTTTAGCTCCCCACCAGATGGAAAATAGGTTAAATTCTGTAAAGATTTAACTTTAACCACAAGAGGGCACAACTGGAGAGCACAATTTTTTTGGTACTGCAGTAAAATTGATTACCTCTTGAGAAGTGTTCTTTTTAACCAGCTATAACAATAGAGTTGAGTATTTTCACCCATGGTTTGAAAAAGTGCCAGAAGGCC