Transcript asmbl_55661

Sequence
Transcript Sequence for observation asmbl_55661 of TGE0056538:
GGGTACTTTGCGCCGCGCTCTTCTGGCGGGGCCCGGGAGGCCGAGGGATCGGCCGGGGCTGCTGCCGCCGGGGGCCTGGGCTTTCCAGCCAGCTGTGGACCAAACGGTCTTCCCTTACCCAAATTAACTGCGCCACGCGCAGGCGGCGCACGGGTTGGGCTTGGGAATGGGGACCGCGAGGCTTCAGCATCCCGATGCCCTGAAAGTCTCCCCGCCTCGGGGATTTGTCTCTGTGTTGCAGCTGGCAGGGGCCGCCTGAAGTGGGAGCAGCGCCTGGAGAAGGCGGGAGGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGGCGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAAACGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTACAGAATGGCCGGATCTGCAATAATGGACGCTGCATCAACACAGATGGCAGTTTTCATTGCGTGTGTAATGCGGGCTTTCATGTTACACGAGATGGGAAGAACTGTGAAGATATGGATGAATGCAGCATAAGGAACATGTGCCTTAATGGAATGTGTATCAATGAAGATGGCAGTTTTAAATGTATTTGCAAACCTGGATTCCAGCTGGCATCAGATGGACGTTATTGCAAAGACATTAACGAGTGTGAAACCCCTGGGATCTGCATGAATGGGCGTTGCGTCAACACTGATGGCTCCTACAGATGTGAATGCTTCCCTGGACTGGCTGTGGGTCTGGATGGCCGTGTGTGTGTTGACACACACATGCGGAGCACATGCTATGGTGGATACAAGAGAGGCCAGTGTATCAAACCTTTGTTTGGTGCTGTCACTAAATCTGAATGCTGTTGCGCCAGCACTGAGTATGCATTTGGGGAACCTTGCCAGCCGTGTCCTGCACAGAATTCAGCGGAATATCAGGCACTCTGCAGCAGTGGGCCAGGAATGACGTCAGCAGGCAGTGATATAAATGAATGTGCACTAGATCCTGATATTTGCCCAAATGGAATCTGTGAAAACCTTCGTGGGACCTATAAATGTATATGCAATTCAGGATATGAAGTGGATTCAACTGGGAAAAACTGCGTTGATATTAATGAATGTGTACTGAACAGTCTCCTTTGTGACAATGGACAATGTAGAAATACTCCTGGAAGTTTTGTCTGTACCTGCCCCAAGGGATTTATCTACAAACCTGATCTAAAAACATGTGAAGACATTGATGAATGCGAATCAAGTCCTTGCATTAATGGAGTCTGCAAGAACAGCCCAGGCTCTTTTATTTGTGAATGTTCTTCTGAAAGTACTTTGGATCCAACAAAAACCATCTGCATAGAAACCATCAAGGGCACTTGCTGGCAGACTGTCATTGATGGGCGATGTGAGATCAACATCAATGGAGCCACCTTAAAGTCCCAGTGCTGCTCCTCCCTCGGTGCTGCGTGGGGAAGCCCGTGCACCCTATGCCAAGTTGATCCCATATGTGGTAAAGGGTACTCAAGAATTAAAGGAACACAATGTGAAGATATAGATGAATGTGAAGTGTTCCCAGGAGTGTGTAAAAATGGCCTGTGTGTTAACACTAGGGGGTCATTCAAGTGTCAGTGTCCCAGTGGAATGACTTTGGATGCCACAGGAAGGATCTGTCTTGATATCCGCCTGGAAACCTGCTTCCTGAGGTACGAGGACGAGGAGTGCACCCTGCCTATTGCTGGCCGCCACCGCATGGACGCCTGCTGCTGCTCCGTCGGGGCAGCCTGGGGTACTGAGGAATGCGAGGAGTGTCCCATGAGAAATACTCCTGAGTACGAGGAGCTGTGTCCGAGAGGACCCGGATTTGCCACAAAAGAAATTACAAATGGAAAGCCTTTCTTCAAAGATATCAATGAGTGCAAGATGATACCCAGCCTCTGCACCCACGGCAAGTGCAGAAACACCATTGGCAGCTTTAAGTGCAGGTGTGACAGCGGCTTTGCTCTTGATTCTGAAGAAAGGAACTGCACAGACATTGACGAATGCCGCATATCTCCTGACCTCTGTGGCAGAGGCCAGTGTGTGAACACCCCTGGGGACTTTGAATGCAAGTGTGACGAAGGCTATGAAAGTGGATTCATGATGATGAAGAACTGCATGGATATTGATGAGTGTCAGAGAGATCCTCTCCTATGCCGAGGTGGTGTTTGCCATAACACAGAGGGAAGTTACCGCTGTGAATGCCCGCCTGGCCATCAGCTGTCCCCCAACATCTCCGCGTGTATCGACATCAATGAATGTGAGCTGAGTGCACACCTGTGCCCCAATGGCCGTTGCGTGAACCTCATAGGGAAGTATCAGTGTGCCTGCAACCCTGGCTACCATTCAACTCCCGATAGGCTATTTTGTGTTGACATTGATGAATGCAGCATAATGAATGGTGGTTGTGAAACCTTCTGCACAAACTCTGAAGGCAGCTATGAATGTAGCTGTCAGCCGGGATTTGCACTAATGCCTGACCAGAGATCATGCACCGACATCGATGAGTGTGAAGATAATCCCAATATCTGTGATGGTGGTCAGTGCACAAATATCCCTGGAGAGTACAGGTGCTTGTGTTATGATGGATTCATGGCATCTGAAGACATGAAGACTTGTGTAGATGTCAATGAGTGTGACCTGAATCCAAATATCTGCCTAAGTGGGACCTGTGAAAACACGAAAGGCTCATTTATCTGCCACTGTGATATGGGCTACTCCGGCAAAAAAGGAAAAACTGGCTGTACAGACATCAATGAATGTGAAATTGGAGCACACAACTGTGGCAAACATGCTGTATGTACCAATACAGCAGGAAGCTTCAAATGTAGCTGCAGTCCCGGGTGGATTGGAGATGGCATTAAGTGCACTGATCTGGACGAATGTTCCAATGGAACCCATATGTGCAGCCAGCATGCAGACTGCAAGAATACCATGGGATCTTACCGCTGTCTGTGCAAGGAAGGATACACAGGTGATGGCTTCACTTGTACAGACCTTGATGAGTGCTCTGAGAACCTGAATCTCTGTGGCAATGGCCAGTGCCTCAATGCACCAGGAGGATACCGCTGTGAATGCGACATGGGCTTCGTGCCCAGTGCTGACGGGAAAGCCTGTGAAGATATTGATGAGTGCTCCCTTCCGAACATCTGTGTCTTTGGAACTTGCCACAACCTCCCTGGCCTGTTCCGCTGTGAGTGTGAGATAGGCTACGAACTGGACAGAAGCGGCGGGAACTGCACAGATGTGAATGAATGCCTGGATCCAACCACGTGCATCAGTGGGAACTGTGTCAACACTCCAGGCAGCTATATCTGTGACTGCCCACCTGATTTTGAACTGAACCCAACTCGAGTTGGCTGTGTTGATACCCGCTCTGGAAATTGCTATTTGGATATTCGACCTCGAGGAGACAATGGAGATACAGCCTGCAGCAATGAAATTGGAGTTGGTGTTTCCAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCCTTGTGAGATGTGTCCTGCTGTGAACACATCCGAGTACAAAATTCTTTGTCCTGGAGGGGAAGGTTTCCGACCAAATCCTATCACCGTTATATTGGAAGATATTGATGAGTGCCAGGAGCTACCAGGGCTGTGCCAAGGAGGAAAATGTATCAACACCTTTGGGAGTTTCCAGTGCCGCTGTCCAACCGGCTACTACCTGAATGAAGATACACGAGTGTGTGATGATGTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCTTTGTCATCGACATTTATACCGGTTTACCCGTTGATATTGATGAGTGCCGGGAGATCCCAGGGGTCTGTGAAAATGGAGTGTGTATCAACATGGTTGGCAGCTTCCGATGTGAATGTCCAGTGGGATTCTTCTATAATGACAAGTTGTTGGTTTGTGAAGATATTGACGAGTGTCAGAACGGCCCAGTGTGCCAGCGCAACGCCGAATGCATCAACACTGCAGGCAGCTACCGCTGTGACTGTAAGCCCGGCTACCGCTTCACCTCCACAGGACAGTGCAATGATCGTAATGAATGTCAAGAAATCCCCAATATATGCAGTCATGGGCAGTGCATTGACACAGTTGGAAGCTTTTATTGCCTTTGCCACACTGGTTTTAAAACAAATGATGACCAAACCATGTGCTTGGACATAAATGAATGTGAAAGAGATGCCTGTGGGAATGGAACTTGCCGGAACACAATTGGTTCCTTCAACTGCCGCTGCAATCATGGTTTCATCCTTTCTCACAACAATGACTGTATAGATGTTGATGAATGTGCAAGTGGAAATGGGAATCTTTGCAGAAATGGCCAATGCATTAATACAGTGGGGTCTTTCCAGTGCCAGTGCAATGAAGGCTATGAGGTGGCTCCAGATGGGAGGACCTGTGTGGATATCAATGAATGTCTTCTAGAACCCAGAAAATGTGCACCAGGTACCTGTCAAAACTTGGATGGGTCCTACAGATGCATTTGCCCACCTGGATACAGTCTTCAAAATGAGAAGTGTGAAGATATTGATGAGTGTGTCGAAGAGCCAGAAATTTGTGCCCTGGGCACATGCAGTAACACTGAAGGCAGCTTCAAATGTCTGTGTCCAGAAGGGTTTTCCTTGTCCTCCAGTGGAAGAAGGTGCCAAGATTTGCGAATGAGCTACTGTTATGCGAAGTTTGAAGGAGGAAAGTGTTCATCACCCAAATCCAGAAATCACTCCAAGCAGGAATGCTGCTGTGCCTTGAAGGGAGAAGGCTGGGGAGACCCCTGCGAGCTCTGCCCCACGGAACCTGATGAGGCCTTCCGCCAGATATGTCCTTATGGAAGTGGGATCATCGTGGGACCTGATGATTCAGCAGTTGATATGGACGAATGCAAAGAACCCGATGTCTGTAAACATGGACAGTGCATCAATACAGATGGTTCCTATCGCTGCGAGTGTCCCTTTGGTTATATTCTAGCAGGGAATGAATGTGTAGATACTGATGAATGTTCTGTTGGCAATCCTTGTGGAAATGGAACCTGCAAGAATGTGATTGGAGGTTTTGAATGCACCTGCGAGGAGGGATTTGAGCCCGGTCCAATGATGACATGTGAAGATATAAATGAATGTGCCCAGAATCCTCTGCTCTGTGCCTTCCGATGTGTGAACACTTATGGGTCATATGAATGCAAATGTCCCGTGGGATATGTGCTCAGAGAAGACCGTAGGATGTGCAAAGATGAGGATGAGTGTGAAGAGGGAAAACATGACTGTACTGAAAAACAAATGGAATGCAAGAACCTCATTGGCACATATATGTGCATCTGTGGACCCGGGTATCAGCGGAGACCTGATGGAGAAGGCTGTGTAGATGAGAATGAATGTCAGACGAAGCCAGGGATCTGTGAGAATGGGCGCTGCCTCAACACCCGTGGGAGCTACACCTGTGAGTGTAATGATGGGTTTACCGCCAGCCCCAACCAGGACGAGTGCCTTGACAATCGGGAAGGGTACTGCTTCACAGAGGTGCTACAAAACATGTGTCAGATCGGCTCCAGCAACAGGAACCCCGTCACCAAATCGGAATGCTGCTGTGACGGAGGGAGAGGCTGGGGTCCCCACTGTGAGATCTGCCCTTTCCAGGGGACTGTGGCTTTCAAGAAACTCTGTCCCCATGGCCGAGGATTCATGACCAATGGAGCAGATATCGATGAATGCAAGGTTATTCACGATGTTTGCCGAAATGGGGAATGTGTCAATGACAGAGGATCATATCATTGCATTTGTAAAACTGGGTACACTCCAGATATAACTGGGACTTCCTGTGTAGATCTGAACGAGTGCAACCAGGCTCCCAAACCCTGCAATTTTATCTGCAAAAACACAGAAGGGAGTTACCAGTGTTCATGCCCGAAAGGCTACATTCTGCAAGAGGATGGAAGGAGCTGCAAAGATCTTGATGAGTGTGCAACCAAGCAACACAACTGCCAGTTCCTATGTGTTAACACCATTGGCGGCTTCACATGCAAATGTCCTCCCGGATTTACCCAACACCATACGTCCTGCATTGATAACAATGAATGCACCTCTGACATCAATCTGTGCGGGTCTAAGGGCATTTGCCAGAACACTCCTGGAAGCTTCACCTGTGAATGCCAGCGGGGATTCTCACTTGATCAGACCGGCTCCAGCTGTGAAGACGTGGACGAGTGTGAGGGTAACCACCGCTGCCAGCATGGCTGCCAGAACATCATTGGGGGCTACAGGTGCAGCTGCCCCCAGGGCTACCTCCAGCACTACCAGTGGAACCAGTGTGTTGATGAAAACGAATGCCTCAGCGCTCACATCTGCGGAGGAGCCTCCTGTCACAACACCCTGGGGAGCTACAAGTGCATGTGTCCCGCCGGCTTCCAGTATGAACAGTTCAGTGGAGGATGCCAAGACATCAATGAATGTGGCTCTGCGCAGGCCCCCTGCAGCTATGGCTGTTCCAATACCGAGGGCGGTTACCTGTGTGGCTGTCCACCTGGTTACTTCCGCATAGGCCAAGGGCACTGTGTTTCTGGAATGGGCATGGGCCGAGGAAACCCAGAGCCACCTGTCAGTGGTGAAATGGATGACAATTCACTCTCCCCAGAGGCTTGTTACGAGTGTAAGATCAATGGCTACCCCAAACGGGGCAGGAAACGGAGAAGCACAAACGAAACTGATGCCTCCAATATCGAGGATCAGTCTGAGACAGAAGCCAATGTGAGTCTTGCAAGTTGGGATGTTGAGAAGACAGCCATCTTTGCTTTCAATATTTCCCACGTCAGTAACAAGGTTCGAATCCTAGAACTCCTTCCAGCTCTTACAACTCTGACGAATCACAACAGATACTTGATCGAATCTGGAAATGAAGATGGCTTCTTTAAAATCAACCAAAAGGAAGGGATCAGCTACCTCCACTTCACAAAGAAGAAGCCAGTGGCTGGAACCTATTCATTACAAATCAGTAGTACTCCACTTTATAAAAAGAAAGAACTTAACCAACTAGAAGACAAATATGACAAAGACTACCTCAGTGGTGAACTGGGTGATAATCTGAAGATGAAAATCCAGGTTTTGCTTCATTAATTCACCATCCAGAGACCAAATAATTAAAAGAAAAACAAATATAGATAGGTAGAACTATATTTTCCCCCAATCAGAATCATCATATCATAGGTACAATCTTTCACCAAGTAAATTTGTATAAATAAGCACTATTCTTTGTATTACCAAAGCAAGGTACAGGTGACTACCCTAGTTCAAAACAACCACTTTCTCAGGCTTCTCATGTGTGTAGCTAAGCTACCTTGTCATATGTGTTGATTCTTGAAAACTGGGACGTGTATTTCCATTGGGGGTTGGCCATTTATGCTGACATGCCATCCTTCCAGCAAACGTACGGGAATGTGCTTTCAATTGATGGACTACTCTATTTTTTGCAAATTTGTAAACTTTGCTTCTCCAAATACAAGTACTAGGTTGTCCATTTATGGTACCTATTTGGTGCTAGTAAATTTTCAAACTAGATTTATAAATGCACTGTAATATGTACACAACTTAGAAACCAAATTACAAGTATTCAGTTCCAATACTTCATTAATTTCAATCAACCAAAGTTAGTTCAGTAGCTTATCTCAGTTATGAGTATAATACATTACATGTAAATTAAGTGTGTGTATACTGTAATCGTGCTATTTTTTATCATTGAAACATTTATAAACTAGAATAATAATGCCCTTAATGTGAGGGTTTGTAATGGTGCTTATTAAGACCAAAGACTTGTTAAATGTATACACCAAGTGGTAATGAAATTTCGGTGACTGGCCCACACGTGCATAGAGGTCTGGGAGGACCAGGAAACAGCCTCAGTGGCCAGAGGATCACCAGTGCATCCTTCATCACAGCATGTGCAATATGCCAAGATTACCCTCGGTCATTCCTGTCAACAAGGGGTCAATGTCATAAATGTCACAATAAAACAATCTCTTCTTTTTTTTAGTTTACCCCTTGGCTTTGTGTTCTTGCATGGATTTGGGGTTGGAGGGGCCATTCCGGAGGCTAAATAAAGTCTCCTGGATTTAAATTATCCTGGGTCTCTTACTTATGGCTTATGAAAGTACCAAATGTATAACCACTAGAAGAAAATTTAACATATGAGTCGATCCCTTGTTTTATCCATTGAAAGTAGCAGAGTCTGGTGTCATTAACCTGACTTGCTTGTGAGAAATTTAGATTGTAGAGTCATTTCTGAAACATGACCTAATTCATCTTGTGACTTTTAAATAGTCTTAAATACCAAGTTCAGTCATTGTCTTAGAGCACATGAATTTCATTATAATAGATTTATCATGCCCCCCTCTCAAATATACACAGTTTTGGCAAGCCTTAGGTGTTCTGTTCCATTTTTTTTTCCCCTAAACATCTTTCGTTAGTCAATGCTCATCTAATTACAAAGGGATAATCCCAGACTGTATCCAATTGCTGTAACTTTTGGTTTCTTAATGTCATAATTTTTAAAGTCTGTTTTATTTTAAGTGCAATATTGAGTATTTAGCTGTTAGGCTCAATCCGTCGATATGAAATAATTTTTTAAATCCCTAAGGGCAGGAAAGCATTTCGTGGTAGTGAAAATAAGAGGAAATAAGATGGCATGAAGGTGGTGGGCGGAGAAACTAGGTAGGACACAGGAAAGTGCTCTCAAAAATCTTTGAAGAGCTCAGCTGAAAAAAATGGAGTAGATTTGGCTCATACTATTCCGGAAGGCAAAACCAGGGTCAGCTGATGTCAGCCCCAGTTTAATACACACGGTCCCAATTATAGAGCTACTCACTGAAAGAATGGGTTTCCTTGCATTGTGGTGAGCTCCCTGTCACAAGATAGAAGAGTTTCAGTCTAGGCTTAATGGCAACCATTGGACAAAGATGCTTTCTTCCACCTAACAGGCCATTAACATCTTAAAGGTATTTTTGTATCTCTAATTTTGTTTATAATAGGTGCTCAACAGAATGAGCTGAATGGCTGTTACAAAGGGGGTTTGTACCTTGGGTAAGAGATTAAAATATAACTCAAAATTTCCTTCTAACGCTGCACCTATGGAACCATGTGATAGAGGTGTATTAAAATTGTTATCGAAGAATATATAGCATATGGTAAACAACAGTTTGCATATGGAAAATGTCTTTGATAATTTAACCAGAACTGCATTATATTCAATAACGGATTTTCTTTATAACAAACAACAGGGGAAAATGGAGTTGGCACACAGTGGATCACTTTGATATTTTTAATAGTCCAAGTCTGGATTTTATTTATTCCTGAGCCAACAATTTTGAACAGCATATTTTCCATGTTTCTGACTGTAACAAAACATTTTCCTCATTGTTCCATTGTAAATATTCCTCTTGTTGGAACTCTTTTTAATCCTGAGATTTAAACCTGTACCTTTCAATTGTCTGTGACCTTTCAATTTCACTTTCAATAGTTGAAGAACTTGGCTTTGTAAATCTCTCAGAAGCTTGAAAATATCTTGTCTCTACCCCCTCAGCCCATTTCATTTGCCAATAATTATTTTGTAAGTAGGGTTGAAATGAACTCAGCTGGCCTTGTGAAATGTTTAAACTTGCACAAACAACTACATTTTTGTTCAACAAATAGCAGTTTACTCAGCCAAAATCACTTTGGATATTGCCATTACAAATACTGTTAAACTTCAGAAATCATGTCTGTAAATTAGATGAGCCAAAATAAAGGACAATTGGGTTGATGCTGCATTAGTATCCTTAAAAGTTATATACCCATAAATGTTAGGG