Transcript asmbl_54816

Sequence
Transcript Sequence for observation asmbl_54816 of TGE0056788:
GGGGAAGTTTGGGCAACTCGGCCTGGCCAATGGAGAGCCTCGGGAGGGCTCTGCCCCTTCCCCCCGCCCCCGCCCGCCTCGGCTCCCGCAGCGCTAGTGTGTCCGCCTAGTTCAGTGTGCGTGGAGATTAGGTCCAAGCGCCCGCCCAGAGGCAGGCAGTCCGCGAGCCCAGCCGCCGCTGTCGCCGCCAGTAGCAGCCTTCGCCAGCAGCGCCGCGGCGGAACCGGGCGCAGGGGAGCGAGCCCGGCCCCGCCAGCCCAGCCCAGCCCAGCCCTACTCCCTCCCCACGCCAGGGCAGCAGCCGTTGCTCAGAGAGAAGGTGGAGGAAGAAATCCAGACCCTAGCACGCGCGCACCATCATGGACCATTATGATTCTCAGCAAACCAACGATTACATGCAGCCAGAAGAGGACTGGGACCGGGACCTGCTCCTGGACCCGGCCTGGGAGAAGCAGCAGAGAAAGACATTCACGGCATGGTGTAACTCCCACCTCCGGAAGGCGGGGACACAGATCGAGAACATCGAAGAGGACTTCCGGGATGGCCTGAAGCTCATGCTGCTGCTGGAGGTCATCTCAGGTGAACGCTTGGCCAAGCCAGAGCGAGGCAAGATGAGAGTGCACAAGATCTCCAACGTCAACAAGGCCCTGGATTTCATAGCCAGCAAAGGCGTCAAACTGGTGTCCATCGGAGCCGAAGAAATCGTGGATGGGAATGTGAAGATGACCCTGGGCATGATCTGGACCATCATCCTGCGCTTTGCCATCCAGGACATCTCCGTGGAAGAGACTTCAGCCAAGGAAGGGCTGCTCCTGTGGTGTCAGAGAAAGACAGCCCCTTACAAAAATGTCAACATCCAGAACTTCCACATAAGCTGGAAGGATGGCCTCGGCTTCTGTGCTTTGATCCACCGACACCGGCCCGAGCTGATTGACTACGGGAAGCTGCGGAAGGATGATCCACTCACAAATCTGAATACGGCTTTTGACGTGGCAGAGAAGTACCTGGACATCCCCAAGATGCTGGATGCCGAAGACATCGTTGGAACTGCCCGACCGGATGAGAAAGCCATCATGACTTACGTGTCTAGCTTCTACCACGCCTTCTCTGGAGCCCAGAAGGCGGAGACAGCAGCCAATCGCATCTGCAAGGTGTTGGCCGTCAACCAGGAGAACGAGCAGCTTATGGAAGACTACGAGAAGCTGGCCAGTGATCTGTTGGAGTGGATCCGCCGCACAATCCCGTGGCTGGAGAACCGGGTGCCCGAGAACACCATGCATGCCATGCAACAGAAGCTGGAGGACTTCCGGGACTACCGGCGCCTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGGCTCAGCAACCGGCCTGCCTTCATGCCCTCTGAGGGCAGGATGGTCTCGGACATCAACAATGCCTGGGGCTGCCTGGAGCAGGTGGAGAAGGGCTATGAGGAGTGGTTGCTGAATGAGATCCGGAGGCTGGAGCGACTGGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACTGACGGCAAAGAGGCCATGCTGCGACAGAAGGACTATGAGACCGCCACCCTCTCGGAGATCAAGGCCCTGCTCAAGAAGCATGAGGCCTTCGAGAGTGACCTGGCTGCCCACCAGGACCGTGTGGAGCAGATTGCCGCCATCGCACAGGAGCTCAATGAGCTGGACTATTATGACTCACCCAGTGTCAACGCCCGTTGCCAAAAGATCTGTGACCAGTGGGACAATCTGGGGGCCCTAACTCAGAAGCGAAGGGAAGCTCTGGAGCGGACCGAGAAACTGCTGGAGACCATTGACCAGCTGTACTTGGAGTATGCCAAGCGGGCTGCACCCTTCAACAACTGGATGGAGGGGGCCATGGAGGACCTGCAGGACACCTTCATTGTGCACACCATTGAGGAGATCCAGGGACTGACCACAGCCCATGAGCAGTTCAAGGCCACCCTCCCTGATGCCGACAAGGAGCGCCTGGCCATCCTGGGCATCCACAATGAGGTGTCCAAGATTGTCCAGACCTACCACGTCAATATGGCGGGCACCAACCCCTACACAACCATCACGCCTCAGGAGATCAATGGCAAATGGGACCACGTGCGGCAGCTGGTGCCTCGGAGGGACCAAGCTCTGACGGAGGAGCATGCCCGACAGCAGCACAATGAGAGGCTACGCAAGCAGTTTGGAGCCCAGGCCAATGTCATCGGGCCCTGGATCCAGACCAAGATGGAGGAGATCGGGAGGATCTCCATTGAGATGCATGGGACCCTGGAGGACCAGCTCAGCCACCTGCGGCAGTATGAGAAGAGCATCGTCAACTACAAGCCAAAGATTGATCAGCTGGAGGGCGACCACCAGCTCATCCAGGAGGCGCTCATCTTCGACAACAAGCACACCAACTACACCATGGAGCACATCCGTGTGGGCTGGGAGCAGCTGCTCACCACCATCGCCAGGACCATCAATGAGGTAGAGAACCAGATCCTGACCCGGGATGCCAAGGGCATCAGCCAGGAGCAGATGAATGAGTTCCGGGCCTCCTTCAACCACTTTGACCGGGATCACTCCGGCACACTGGGTCCCGAGGAGTTCAAAGCCTGCCTCATCAGCTTGGGTTATGATATTGGCAACGACCCCCAGGGAGAAGCAGAATTTGCCCGCATCATGAGCATTGTGGACCCCAACCGCCTGGGGGTAGTGACATTCCAGGCCTTCATTGACTTCATGTCCCGCGAGACAGCCGACACAGATACAGCAGACCAAGTCATGGCTTCCTTCAAGATCCTGGCTGGGGACAAGAACTACATTACCATGGACGAGCTGCGCCGCGAGCTGCCACCCGACCAGGCTGAGTACTGCATCGCGCGGATGGCCCCCTACACCGGCCCCGACTCCGTGCCAGGTGCTCTGGACTACATGTCCTTCTCCACGGCGCTGTACGGCGAGAGTGACCTCTAATCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTGCCCTGCCTTGCACCTCCGCCGTCGCCCATCTCCTGCCTGGGTTCGGTTTCAGCTCCCAGCCTCCACCCGGGTGAGCTGGGGCCCACGTGGCATCGATCCTCCCTGCCCGCGAAGTGACAGTTTACAAAATTATTTTCTGCAAAAAAGAAAAAAAAGTTACGTTAAAAACCAAAAAACTACATATTTTATTATAGAAAAAGTATTTTTTCTCCACCAGACAAATGGAAAAAAAGAGGAAAGATTAACTATTTGCACCGAAATGTCTTGTTTTGTTGCGACATAGGAAAATAACCAAGCACAAAGTTATATTCCATCCTTTTTACTGATTTTTTTTTCTTCTATCTGTTCCATCTGCTGTATTCATTTCTCCAATCTCATGTCCATTTTGGTGTGGGAGTCGGGGTAGGGGGTACTCTTGTCAAAAGGCACATTGGTGCATGTGTGTTTGCTAGCTCACTTGTCCATGAAAATATTTTATGATATTAAAGAAAATCTTTTGAAATGGCTGTTTTTTAAGGAAGAGAATTTATGTGGCTTCTCATTTTTAAATCCCCTCAGAGGTGTGACTAGTCTCTTTATCAGCACACACTTAAAAAATTTTTAATATTGTCTATTAAAAATAGGACAAACTTGGAGAGTATGGACAACTTTGATATTGCTTGGCACAGATGGTATTAAAAAAACCACACTCCTATGACAGCTCTTTGCCTGCTCCTTGCTTGATGTTTTCTGGAAGTGTGTGTGGGGTCAAGGATGGTGTGGGGCACCTGTATCTACTCCTAATGTTTTTGACCCTGCTGTGTTCAATCTTCTTACACTTCAGTTTCTTCATTTTAAAAAGGAAAAGGTAATTTCTTCACAGTCTCCTATGAGTTGGACAGAAAGTCATGGATGTGTAAAGGACTTCTTGATGATAAGCCCCACCTTCATTTTTCCACGGCACCAAACAGCCCTGTGACATCTGCATTCACCCCACTCGTTTTATTTTTGCTGCAGTGAACAGCTTGAGTTGTCTCTTAAGAGTCATCTCATCCCTTGCTATTCGAGATGACCCACAGATGGCAGCTGTTCAGCATCACCTGGGAGTTCATTGGAAATACAGAATCTCAGGCCCCACCCCTGAATGTCGAATACTGTGTGTACTGCTCTAGCTTCTCCAGAGTAAAAGATAGTCTCTATAGGATGCCGTCTGCTCTGGCACCAGGCCCCCTGAGCCCATGCCTTTTATCTGACGTTTGTTTTGCAACCCATTACATCACTTGCCCCCGGGCATCCTTTAAATTTCATCCTTGGCTAATTCTCATTGTAACCGGTTCCAGCTTGCTTTAAATGATTGGGTGGATGGAATTCTCCCCATTGACAATTGACAGGTGGCAATTAATTGTTCATGCCTCAGTGGGATGAATCCATTACATCTCTTTCCTGCCTAATATTTTTATCTACCTCCGACTTTTTTGTAGGGACTTTGTTGATATCCTCATGAAGGCCCATCTCTCCTCTCTCTGGCTTGTCCATCCCTTGACAAAACCTTAATGACTGTTCTGGGTACCAAATCTGTGGCAGGAGTGTGACCCAGCTGCCACCCACCTCCTCCATCACTGGACCAGCTCATAGTTGTCCCTTGGACATGGGGTTAGTGCCCAACAAGTGTAGTCATTTGGCTAAGTGAGTTACTAGGAGGGAGAACAGATTCAATTTCCTGAGGTGGTGAGGAGAGACTGAAGGCTTTGCCAGTTCTTTGGCCTATGCCAGGCTCTCTGGTACTTCTGCAGGTGGCATGAGCTGTGTGAAGCGCCTCTAAATTTAAGGCTCCAAAGCTCTCCAACACAAACAAGACTTTAGGGTCTGCGTTATGGACGCCAAGGGAAGAAATACAACCTCAACATCAGTGCCTGTCAAGGGAGGCAGATGTGAGCTCGTCTGCCTGCCACCGGCCATTTGGACTACCTTGGGCAAGTGACCTCCTTAAATGGGGCCGATAATGTTGCTTTCCTTCTCTCCCTGGCACACAGTAGGCATTTAATAAGTGGCAATGGGTATTGTCCCTAGAGTTGTATAAAAAACCAGCTCTAGCAGGGCGTGGTGGTGCATGTCCGTAGTGCCAGCTGCTTGGGAGGCTGAGG