Transcript asmbl_42420

Sequence
Transcript Sequence for observation asmbl_42420 of TGE0061243:
CAGCTATTGTGGTGGGAAAGGGAGGGTGGTTGGTGGATGTCACAGCTTGGGCTTTATCTCCCCCAGCAGTGGGGACTCCACAGCCCCTGGGCTACATAACAGCAAGACAGTCCGGAGCTGTAGCAGACCTGATTGAGCCTTTGCAGCAGCTGAGAGCATGGCCTAGGGTGGGCGGCACCATTGTCCAGCAGCTGAGTTTCCCAGGGACCTTGGAGATAGCCGCAGCCCTCATTTGCAGGGGAAGATGATTCCTGCCAGATTTGCCGGGGTGCTGCTTGCTCTGGCCCTCATTTTGCCAGGGACCCTTTGTGCAGAAGGAACTCGCGGCAGGTCATCCACGGCCCGATGCAGCCTTTTCGGAAGTGACTTCGTCAACACCTTTGATGGGAGCATGTACAGCTTTGCGGGATACTGCAGTTACCTCCTGGCAGGGGGCTGCCAGAAACGCTCCTTCTCGATTATTGGGGACTTCCAGAATGGCAAGAGAGTGAGCCTCTCCGTGTATCTTGGGGAATTTTTTGACATCCATTTGTTTGTCAATGGTACCGTGACACAGGGGGACCAAAGAGTCTCCATGCCCTATGCCTCCAAAGGGCTGTATCTAGAAACTGAGGCTGGGTACTACAAGCTGTCCGGTGAGGCCTATGGCTTTGTGGCCAGGATCGATGGCAGCGGCAACTTTCAAGTCCTGCTGTCAGACAGATACTTCAACAAGACCTGCGGGCTGTGTGGCAACTTTAACATCTTTGCTGAAGATGACTTTATGACCCAAGAAGGGACCTTGACCTCGGACCCTTATGACTTTGCCAACTCATGGGCTCTGAGCAGTGGAGAACAGTGGTGTGAACGGGCATCTCCTCCCAGCAGCTCATGCAACATCTCCTCTGGGGAAATGCAGAAGGGCCTGTGGGAGCAGTGCCAGCTTCTGAAGAGCACCTCGGTGTTTGCCCGCTGCCACCCTCTGGTGGACCCCGAGCCTTTTGTGGCCCTGTGTGAGAAGACTTTGTGTGAGTGTGCTGGGGGGCTGGAGTGCGCCTGCCCTGCCCTCCTGGAGTACGCCCGGACCTGTGCCCAGGAGGGAATGGTGCTGTACGGCTGGACCGACCACAGCGCGTGCAGCCCAGTGTGCCCTGCTGGTATGGAGTATAGGCAGTGTGTGTCCCCTTGCGCCAGGACCTGCCAGAGCCTGCACATCAATGAAATGTGTCAGGAGCGATGCGTGGATGGCTGCAGCTGCCCTGAGGGACAGCTCCTGGATGAAGGCCTCTGCGTGGAGAGCACCGAGTGTCCCTGCGTGCATTCCGGAAAGCGCTACCCTCCCGGCACCTCCCTCTCTCGAGACTGCAACACCTGCATTTGCCGAAACAGCCAGTGGATCTGCAGCAATGAAGAATGTCCAGGGGAGTGCCTTGTCACAGGTCAATCACACTTCAAGAGCTTTGACAACAGATACTTCACCTTCAGTGGGATCTGCCAGTACCTGCTGGCCCGGGATTGCCAGGACCACTCCTTCTCCATTGTCATTGAGACTGTCCAGTGTGCTGATGACCGCGACGCTGTGTGCACCCGCTCCGTCACCGTCCGGCTGCCTGGCCTGCACAACAGCCTTGTGAAACTGAAGCATGGGGCAGGAGTTGCCATGGATGGCCAGGACGTCCAGCTCCCCCTCCTGAAAGGTGACCTCCGCATCCAGCATACAGTGACGGCCTCCGTGCGCCTCAGCTACGGGGAGGACCTGCAGATGGACTGGGATGGCCGCGGGAGGCTGCTGGTGAAGCTGTCCCCCGTCTATGCCGGGAAGACCTGCGGCCTGTGTGGGAATTACAATGGCAACCAGGGCGACGACTTCCTTACCCCCTCTGGGCTGGCGGAGCCCCGGGTGGAGGACTTCGGGAACGCCTGGAAGCTGCACGGGGACTGCCAGGACCTGCAGAAGCAGCACAGCGATCCCTGCGCCCTCAACCCGCGCATGACCAGGTTCTCCGAGGAGGCGTGCGCGGTCCTGACGTCCCCCACATTCGAGGCCTGCCATCGTGCCGTCAGCCCGCTGCCCTACCTGCGGAACTGCCGCTACGACGTGTGCTCCTGCTCGGACGGCCGCGAGTGCCTGTGCGGCGCCCTGGCCAGCTATGCCGCGGCCTGCGCGGGGAGAGGCGTGCGCGTCGCGTGGCGCGAGCCAGGCCGCTGTGAGCTGAACTGCCCGAAAGGCCAGGTGTACCTGCAGTGCGGGACCCCCTGCAACCTGACCTGCCGCTCTCTCTCTTACCCGGATGAGGAATGCAATGAGGCCTGCCTGGAGGGCTGCTTCTGCCCCCCAGGGCTCTACATGGATGAGAGGGGGGACTGCGTGCCCAAGGCCCAGTGCCCCTGTTACTATGACGGTGAGATCTTCCAGCCAGAAGACATCTTCTCAGACCATCACACCATGTGCTACTGTGAGGATGGCTTCATGCACTGTACCATGAGTGGAGTCCCCGGAAGCTTGCTGCCTGACGCTGTCCTCAGCAGTCCCCTGTCTCATCGCAGCAAAAGGAGCCTATCCTGTCGGCCCCCCATGGTCAAGCTGGTGTGTCCCGCTGACAACCTGCGGGCTGAAGGGCTCGAGTGTACCAAAACGTGCCAGAACTATGACCTGGAGTGCATGAGCATGGGCTGTGTCTCTGGCTGCCTCTGCCCCCCGGGCATGGTCCGGCATGAGAACAGATGTGTGGCCCTGGAAAGGTGTCCCTGCTTCCATCAGGGCAAGGAGTATGCCCCTGGAGAAACAGTGAAGATTGGCTGCAACACTTGTGTCTGTCAGGACCGGAAGTGGAACTGCACAGACCATGTGTGTGATGCCACGTGCTCCACGATCGGCATGGCCCACTACCTCACCTTCGACGGGCTCAAATACCTGTTCCCCGGGGAGTGCCAGTACGTTCTGGTGCAGGATTACTGCGGCAGTAACCCTGGGACCTTTCGGATCCTAGTGGGGAATAAGGGATGCAGCCACCCCTCAGTGAAATGCAAGAAACGGGTCACCATCCTGGTGGAGGGAGGAGAGATTGAGCTGTTTGACGGGGAGGTGAATGTGAAGAGGCCCATGAAGGATGAGACTCACTTTGAGGTGGTGGAGTCTGGCCGGTACATCATTCTGCTGCTGGGCAAAGCCCTCTCCGTGGTCTGGGACCGCCACCTGAGCATCTCCGTGGTCCTGAAGCAGACATACCAGGAGAAAGTGTGTGGCCTGTGTGGGAATTTTGATGGCATCCAGAACAATGACCTCACCAGCAGCAACCTCCAAGTGGAGGAAGACCCTGTGGACTTTGGGAACTCCTGGAAAGTGAGCTCGCAGTGTGCTGACACCAGAAAAGTGCCTCTGGACTCATCCCCTGCCACCTGCCATAACAACATCATGAAGCAGACGATGGTGGATTCCTCCTGTAGAATCCTTACCAGTGACGTCTTCCAGGACTGCAACAAGCTGGTGGACCCCGAGCCATATCTGGATGTCTGCATTTACGACACCTGCTCCTGTGAGTCCATTGGGGACTGCGCCTGCTTCTGCGACACCATTGCTGCCTATGCCCACGTGTGTGCCCAGCATGGCAAGGTGGTGACCTGGAGGACGGCCACATTGTGCCCCCAGAGCTGCGAGGAGAGGAATCTCCGGGAGAACGGGTATGAGTGTGAGTGGCGCTATAACAGCTGTGCACCTGCCTGTCAAGTCACGTGTCAGCACCCTGAGCCACTGGCCTGCCCTGTGCAGTGTGTGGAGGGCTGCCATGCCCACTGCCCTCCAGGGAAAATCCTGGATGAGCTTTTGCAGACCTGCGTTGACCCTGAAGACTGTCCAGTGTGTGAGGTGGCTGGCCGGCGTTTTGCCTCAGGAAAGAAAGTCACCTTGAATCCCAGTGACCCTGAGCACTGCCAGATTTGCCACTGTGATGTTGTCAACCTCACCTGTGAAGCCTGCCAGGAGCCGGGAGGCCTGGTGGTGCCTCCCACAGATGCCCCGGTGAGCCCCACCACTCTGTATGTGGAGGACATCTCGGAACCGCCGTTGCACGATTTCTACTGCAGCAGGCTACTGGACCTGGTCTTCCTGCTGGATGGCTCCTCCAGGCTGTCCGAGGCTGAGTTTGAAGTGCTGAAGGCCTTTGTGGTGGACATGATGGAGCGGCTGCGCATCTCCCAGAAGTGGGTCCGCGTGGCCGTGGTGGAGTACCACGACGGCTCCCACGCCTACATCGGGCTCAAGGACCGGAAGCGACCGTCAGAGCTGCGGCGCATTGCCAGCCAGGTGAAGTATGCGGGCAGCCAGGTGGCCTCCACCAGCGAGGTCTTGAAATACACACTGTTCCAAATCTTCAGCAAGATCGACCGCCCTGAAGCCTCCCGCATCACCCTGCTCCTGATGGCCAGCCAGGAGCCCCAACGGATGTCCCGGAACTTTGTCCGCTACGTCCAGGGCCTGAAGAAGAAGAAGGTCATTGTGATCCCGGTGGGCATTGGGCCCCATGCCAACCTCAAGCAGATCCGCCTCATCGAGAAGCAGGCCCCTGAGAACAAGGCCTTCGTGCTGAGCAGTGTGGATGAGCTGGAGCAGCAAAGGGACGAGATCGTTAGCTACCTCTGTGACCTTGCCCCTGAAGCCCCTCCTCCTACTCTGCCCCCCGACATGGCACAAGTCACTGTGGGCCCGGGGCTCTTGGGGGTTTCGACCCTGGGGCCCAAGAGGAACTCCATGGTTCTGGATGTGGCGTTCGTCCTGGAAGGATCGGACAAAATTGGTGAAGCCGACTTCAACAGGAGCAAGGAGTTCATGGAGGAGGTGATTCAGCGGATGGATGTGGGCCAGGACAGCATCCACGTCACGGTGCTGCAGTACTCCTACATGGTGACTGTGGAGTACCCCTTCAGCGAGGCACAGTCCAAAGGGGACATCCTGCAGCGGGTGCGAGAGATCCGCTACCAGGGCGGCAACAGGACCAACACTGGGCTGGCCCTGCGGTACCTCTCTGACCACAGCTTCTTGGTCAGCCAGGGTGACCGGGAGCAGGCGCCCAACCTGGTCTACATGGTCACCGGAAATCCTGCCTCTGATGAGATCAAGAGGCTGCCTGGAGACATCCAGGTGGTGCCCATTGGAGTGGGCCCTAATGCCAACGTGCAGGAGCTGGAGAGGATTGGCTGGCCCAATGCCCCTATCCTCATCCAGGACTTTGAGACGCTCCCCCGAGAGGCTCCTGACCTGGTGCTGCAGAGGTGCTGCTCCGGAGAGGGGCTGCAGATCCCCACCCTCTCCCCTGCACCTGACTGCAGCCAGCCCCTGGACGTGATCCTTCTCCTGGATGGCTCCTCCAGTTTCCCAGCTTCTTATTTTGATGAAATGAAGAGTTTCGCCAAGGCTTTCATTTCAAAAGCCAATATAGGGCCTCGTCTCACTCAGGTGTCAGTGCTGCAGTATGGAAGCATCACCACCATTGACGTGCCATGGAACGTGGTCCCGGAGAAAGCCCATTTGCTGAGCCTTGTGGACGTCATGCAGCGGGAGGGAGGCCCCAGCCAAATCGGGGATGCCTTGGGCTTTGCTGTGCGATACTTGACTTCAGAAATGCATGGTGCCAGGCCGGGAGCCTCAAAGGCGGTGGTCATCCTGGTCACGGACGTCTCTGTGGATTCAGTGGATGCAGCAGCTGATGCCGCCAGGTCCAACAGAGTGACAGTGTTCCCTATTGGAATTGGAGATCGCTACGATGCAGCCCAGCTACGGATCTTGGCAGGCCCAGCAGGCGACTCCAACGTGGTGAAGCTCCAGCGAATCGAAGACCTCCCTACCATGGTCACCTTGGGCAATTCCTTCCTCCACAAACTGTGCTCTGGATTTGTTAGGATTTGCATGGATGAGGATGGGAATGAGAAGAGGCCCGGGGACGTCTGGACCTTGCCAGACCAGTGCCACACCGTGACTTGCCAGCCAGATGGCCAGACCTTGCTGAAGAGTCATCGGGTCAACTGTGACCGGGGGCTGAGGCCTTCGTGCCCTAACAGCCAGTCCCCTGTTAAAGTGGAAGAGACCTGTGGCTGCCGCTGGACCTGCCCCTGCGTGTGCACAGGCAGCTCCACTCGGCACATCGTGACCTTTGATGGGCAGAATTTCAAGCTGACTGGCAGCTGTTCTTATGTCCTATTTCAAAACAAGGAGCAGGACCTGGAGGTGATTCTCCATAATGGTGCCTGCAGCCCTGGAGCAAGGCAGGGCTGCATGAAATCCATCGAGGTGAAGCACAGTGCCCTCTCCGTCGAGCTGCACAGTGACATGGAGGTGACGGTGAATGGGAGACTGGTCTCTGTTCCTTACGTGGGTGGGAACATGGAAGTCAACGTTTATGGTGCCATCATGCATGAGGTCAGATTCAATCACCTTGGTCACATCTTCACATTCACTCCACAAAACAATGAGTTCCAACTGCAGCTCAGCCCCAAGACTTTTGCTTCAAAGACGTATGGTCTGTGTGGGATCTGTGATGAGAACGGAGCCAATGACTTCATGCTGAGGGATGGCACAGTCACCACAGACTGGAAAACACTTGTTCAGGAATGGACTGTGCAGCGGCCAGGGCAGACGTGCCAGCCCATCCTGGAGGAGCAGTGTCTTGTCCCCGACAGCTCCCACTGCCAGGTCCTCCTCTTACCACTGTTTGCTGAATGCCACAAGGTCCTGGCTCCAGCCACATTCTATGCCATCTGCCAGCAGGACAGTTGCCACCAGGAGCAAGTGTGTGAGGTGATCGCCTCTTATGCCCACCTCTGTCGGACCAACGGGGTCTGCGTTGACTGGAGGACACCTGATTTCTGTGCTATGTCATGCCCACCATCTCTGGTCTACAACCACTGTGAGCATGGCTGTCCCCGGCACTGTGATGGCAACGTGAGCTCCTGTGGGGACCATCCCTCCGAAGGCTGTTTCTGCCCTCCAGATAAAGTCATGTTGGAAGGCAGCTGTGTCCCTGAAGAGGCCTGCACTCAGTGCATTGGTGAGGATGGAGTCCAGCACCAGTTCCTGGAAGCCTGGGTCCCGGACCACCAGCCCTGTCAGATCTGCACATGCCTCAGCGGGCGGAAGGTCAACTGCACAACGCAGCCCTGCCCCACGGCCAAAGCTCCCACGTGTGGCCTGTGTGAAGTAGCCCGCCTCCGCCAGAATGCAGACCAGTGCTGCCCCGAGTATGAGTGTGTGTGTGACCCAGTGAGCTGTGACCTGCCCCCAGTGCCTCACTGTGAACGTGGCCTCCAGCCCACACTGACCAACCCTGGCGAGTGCAGACCCAACTTCACCTGCGCCTGCAGGAAGGAGGAGTGCAAAAGAGTGTCCCCACCCTCCTGCCCCCCGCACCGTTTGCCCACCCTTCGGAAGACCCAGTGCTGTGATGAGTATGAGTGTGCCTGCAACTGTGTCAACTCCACAGTGAGCTGTCCCCTTGGGTACTTGGCCTCAACTGCCACCAATGACTGTGGCTGTACCACAACCACCTGCCTTCCCGACAAGGTGTGTGTCCACCGAAGCACCATCTACCCTGTGGGCCAGTTCTGGGAGGAGGGCTGCGATGTGTGCACCTGCACCGACATGGAGGATGCCGTGATGGGCCTCCGCGTGGCCCAGTGCTCCCAGAAGCCCTGTGAGGACAGCTGTCGGTCGGGCTTCACTTACGTTCTGCATGAAGGCGAGTGCTGTGGAAGGTGCCTGCCATCTGCCTGTGAGGTGGTGACTGGCTCACCGCGGGGGGACTCCCAGTCTTCCTGGAAGAGTGTCGGCTCCCAGTGGGCCTCCCCGGAGAACCCCTGCCTCATCAATGAGTGTGTCCGAGTGAAGGAGGAGGTCTTTATACAACAAAGGAACGTCTCCTGCCCCCAGCTGGAGGTCCCTGTCTGCCCCTCGGGCTTTCAGCTGAGCTGTAAGACCTCAGCGTGCTGCCCAAGCTGTCGCTGTGAGCGCATGGAGGCCTGCATGCTCAATGGCACTGTCATTGGGCCCGGGAAGACTGTGATGATCGATGTGTGCACGACCTGCCGCTGCATGGTGCAGGTGGGGGTCATCTCTGGATTCAAGCTGGAGTGCAGGAAGACCACCTGCAACCCCTGCCCCCTGGGTTACAAGGAAGAAAATAACACAGGTGAATGTTGTGGGAGATGTTTGCCTACGGCTTGCACCATTCAGCTAAGAGGAGGACAGATCATGACACTGAAGCGTGATGAGACGCTCCAGGATGGCTGTGATACTCACTTCTGCAAGGTCAATGAGAGAGGAGAGTACTTCTGGGAGAAGAGGGTCACAGGCTGCCCACCCTTTGATGAACACAAGTGTCTGGCTGAGGGAGTGAGTACTCATTCTGCTTTCCTCTTTACTGTCTCAATCTCTAAGAACAAGATTCTTCTGAATAGTGTGCATCCCAGCTCCG