Transcript asmbl_33416

Sequence
Transcript Sequence for observation asmbl_33416 of TGE0004935:
GTCCGCTCCCTGACCATCCCCTCCACGCCGCCCGCTGAAACCCAGCCAGAGCGCGTACTTGCACCCCGCCCCGTACTCTGACTCAGCAGTAGTCACCTTGTCCCGCCCGTGAAGCCGGAAAGTTCGCGATTCCGATAGCTTTGCGAGCGAGGTGGAGAGGGGACTTCAGAGACAGCACAGGTGGCAAGTAAAGATTTCACCCCTTTGCTTGTGAGTCATGGCAGCTCCCATGAAGAGCCAAGTGTGCGTGGTGACTGGTGCTTCCAGAGGTATTGGCCGTGGCATCGCCTTACAGCTCTGCCAAGCAGGTGCCACAGTTTACGTGACTGGCCGACATCTGGACACACTGCGGGCCACTGCTCAGGATGCACAATCCCGAGGGGGGCGGTGTATACCTGTGGTGTGCGATTCAAGCCAGGAGAGTGAAGTGCGAAGCCTCTTTGAGCAGGTGGCTCGAGAACAGGGGCGTCTGGATGTGCTGGTCAACAATGCCTATGCAGGGGTCCAGGCAGTCCTGAACAACATTAATAAAGCATTCTGGGAAACACCTGCCTCCTTCTGGGATGATATCAACAATGTTGGACTCAGAGGCCACTACTTGTGCTCGGTCTATGGGGCACGGCTGATGGTACCAGCTGGCCGGGGGCTCATCGTGGTCATCTCCTCCATTGGGGGGCTGAAATATCTAGCCAATGTCCCCTACGGCGTCGGTAAAGCTGCGTGCGACAGGTTGGCTGCTGACTGTGCCCTCGAGCTGCGGCGTCATGGGGTCAGCTACGTGTCTCTTTGGCCAGGATTGGTGCAAACAGAACTGCTGAAGGACTATTTGAGGAACAATGACAATGCTGAAGATTCTCTGCTTAAGCAGTTCTCGTCTGCGGAGACCACAGAAATGAGCGGAAAATGTGTGGTGGCTTTGGCAACAGACCCCAATATCTTGAGCCTGAGTGGAAAGGTACTGCCATCCTGTGACCTTGCTCGACGCTACGGCCTTCGGGATGTGGATGGCCGCCCCGTCTGGGACTATTTGTCTTTGAGCTCTGTTATCTCCCACGCCTCTAGCCTGGGCTGGCTGGCCTCCTACTTGCCTGGCTTCCTTCGTGTGCCCAAGTGGGTTATGACTCTCTACACTAGCAAGTTCTAACATTCTTGGCCTGATGTCACCACCCTGCTTGTCTTTTCAGTTGGCCTGGGTGGTTGGGCCTGTCTTAGTGGAACAAGGCAGCCTTTCCCGCCTTGCCCTTGATTCAAAGAGAAAGACTCTGCTACGTGTCCTGGGTAGGTCCTGGGGACCCTGTAGATCCTTATTTGTGCCTTGGTTTTCCTTACCCCTGCATTTTACTTTTTGCCTTCCTATCGAAAAATGCTCTGGGTACTAATAAAGGTCTCATTTCTCCTTCAGGGCATTTTTTGAGTGCTGATTCTATGCTGGGCCAAGTGTTAAGTACTTGAGAGAAGT