Transcript asmbl_147124

Sequence
Transcript Sequence for observation asmbl_147124 of TGE0056404:
TGGGAGTAGAAGGTAAAAAGGGAGTGGTGAGAATGAATGTGAGAAGGAAGCCAGGACAGCGCAGTCCCCAGTCCCGAACGGCCAGGGAGAGGAGGTGGCCTAGCGCTGGCGGGGCTCACCCCAATCCGTCTGCCTTTTGATGCCGTACTGTAAGCTCCGTCCATCTCTGCTGGTTGCGCAGCCACCTCGGGATACTGCACACGGAGAGGAGGGAAAATAAGCGAGGCACCGCCGCACCACGCGGGAGACCTACGGAGACCCACAGCGCCCGAGCCCTGGAAGAGCACTACTGGATGTCAGCGGAGAAATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCCTGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGAAATGCAATGCTGGATTCTTTCACACCCTGTCGGGAGAATGTGTGCCCTGCGACTGTAATGGCAATTCCAACGAGTGTTTGGACGGCTCAGGATACTGTGTGCACTGCCAGCGGAACACAACAGGAGAGCACTGTGAAAAGTGTCTGGATGGTTATATCGGAGATTCCATCAGGGGAGCACCCCAATTCTGCCAGCCGTGCCCCTGTCCCCTGCCCCACTTGGCCAATTTTGCAGAATCCTGCTATAGGAAAAATGGAGCTGTTCGGTGCATTTGTAACGAAAATTATGCTGGACCTAACTGTGAAAGATGTGCTCCCGGTTACTATGGAAACCCCTTACTCATTGGAAGCACCTGTAAGAAATGTGACTGCAGTGGAAATTCAGATCCCAACCTGATCTTTGAAGATTGTGATGAAGTCACTGGCCAGTGTAGGAATTGCTTACGCAACACCACCGGATTCAAGTGTGAACGTTGCGCTCCTGGCTACTATGGGGACGCCAGGATAGCCAAGAACTGTGCAGTGTGCAACTGCGGGGGAGGCCCATGTGACAGTGTAACCGGAGAATGCTTGGAAGAAGGTTTTGAACCCCCTACAGGCTGTGATAAGTGCGTCTGGGACCTGACTGATGACCTGCGGTTAGCAGCGCTCTCCATCGAGGAAGGCAAATCCGGGGTGCTGAGCGTATCCTCTGGGGCCGCCGCTCATAGGCACGTGAATGAAATCAACGCCACCATCTACCTCCTCAAAACAAAATTGTCAGAAAGAGAAAACCAATACGCCCTAAGAAAGATACAAATCAACAATGCTGAGAACACGATGAAAAGCCTTCTGTCTGACGTAGAGGAATTAGTTGAAAAGGAAAATCAAGCCTCCAGAAAAGGACAACTTGTTCAGAAGGAAAGCATGGACACCATTAACCACGCAAGTCAGCTGGTAGAGCAAGCCCATGATATGAGGGATAAAATCCAAGAGATCAACAACAAGATGCTCTATTATGGGGAAGAGCATGAACTTAGCCCCAAGGAAATCTCTGAGAAGCTGGTGTTGGCCCAGAAGATGCTTGAAGAGATTAGAAGCCGTCAACCATTTTTCACCCAACGGGAGCTCGTGGATGAGGAGGCAGATGAGGCTTACGAACTACTGAGCCAGGCTGAGAGCTGGCAGCGGCTGCACAATGAGACCCGCACTCTGTTTCCTGTCGTCCTGGAGCAGCTGGATGACTACAATGCTAAGTTGTCAGATCTCCAGGAAGCACTTGACCAGGCCCTTAACTATGTCAGGGATGCCGAAGACATGAACAGGGCCACAGCAGCCAGGCAGCGGGACCATGAGAAACAACAGGAAAGAGTGAGGGAACAAATGGAAGTGGTGAACATGTCTCTGAGCACATCTGCGGACTCTCTGACAACACCTCGTCTAACTCTTTCAGAACTTGATGATATAATAAAGAATGCGTCAGGGATTTATGCAGAAATAGATGGAGCCAAAAGTGAACTACAAGTAAAACTATCTAACCTAAGTAACCTCAGCCATGATTTAGTCCAAGAAGCTATTGACCATGCACAGGACCTTCAACAAGAAGCTAATGAATTGAGCAGGAAGTTGCACAGTTCAGATATGAACGGGCTGGTACAGAAGGCTTTGGATGCATCAAATGTCTATGAAAATATTGTTAATTATGTTAGTGAAGCCAATGAAACAGCAGAATTTGCTTTGAACACCACTGACCGAATTTATGATGCGGTGAGTGGGATTGATACTCAAATCATTTACCATAAAGATGAAAGTGAGAACCTCCTCAATCAAGCCAGAGAACTGCAAGCAAAGGCAGAGTCTAGCAGTGATGAAGCAGTGGCTGACACTAGCAGGCGTGTGGGTGGAGCCCTAGCAAGGAAAAGTGCCCTTAAAACCAGACTCAGTGATGCCGTTAAGCAACTACAAGCAGCAGAGAGAGGGGATGCCCAGCAGCGCCTGGGGCAGTCTAGACTGATCACCGAGGAAGCCAACAGGACGACGATGGAGGTGCAGCAGGCCACTGCCCCCATGGCCAACAATCTAACCAACTGGTCACAGAATCTTCAACATTTTGACTCTTCTGCTTACAACACTGCAGTGAACTCTGCTAGGGATGCAGTAAGAAATCTGACCGAGGTTGTCCCTCAGCTCCTGGATCAGCTTCGTACGGTTGAGCAGAAGCGACCTGCAAGCAACGTTTCTGCCAGCATCCAGAGGATCCGAGAGCTCATTGCTCAGACCAGAAGTGTTGCCAGCAAGATCCAAGTCTCCATGATGTTTGATGGCCAGTCAGCTGTGGAAGTGCACTCGAGAACCAGTATGGATGACTTAAAGGCCTTCACGTCTCTGAGCCTGTACATGAAACCCCCTGTGAAGCGGCCGGAACTGACCGAGACTGCAGATCAGTTTATCCTGTACCTCGGAAGCAAAAACGCCAAAAAAGAGTATATGGGTCTTGCAATCAAAAATGATAATCTGGTATACGTCTATAATTTGGGAACTAAAGATGTGGAGATTCCCCTGGACTCCAAGCCCGTCAGTTCCTGGCCTGCTTACTTCAGCATTGTCAAGATTGAAAGGGTGGGAAAACATGGAAAGGTGTTTTTAACAGTCCCGAGTCTAAGTAGCACAGCAGAGGAAAAGTTCATTAAAAAGGGGGAATTTTCGGGAGATGACTCTCTGCTGGACCTGGACCCTGAGGACACAGTGTTTTATGTTGGTGGAGTGCCTTCCAACTTCAAGCTCCCTACCAGCTTAAACCTGCCTGGCTTTGTTGGCTGCCTGGAACTGGCCACTTTGAATAATGATGTGATCAGCTTGTACAACTTTAAGCACATCTATAATATGGACCCCTCCACATCAGTGCCATGTGCCCGAGATAAGCTGGCCTTCACTCAGAGTCGGGCTGCCAGTTACTTCTTCGATGGCTCCGGTTATGCCGTGGTGAGAGACATCACAAGGAGAGGGAAATTTGGTCAGGTGACTCGCTTTGACATAGAAGTTCGAACACCAGCTGACAACGGCCTTATTCTCCTGATGGTCAATGGAAGTATGTTTTTCAGACTGGAAATGCGCAATGGTTACCTACATGTGTTCTATGATTTTGGATTCAGCGGTGGCCCTGTGCATCTTGAAGATACGTTAAAGAAAGCTCAAATTAATGATGCAAAATACCATGAGATCTCAATCATTTACCACAATGATAAGAAAATGATCTTGGTAGTTGACAGAAGGCATGTCAAGAGCATGGATAATGAAAAGATGAAAATACCTTTTACAGATATATACATTGGAGGAGCTCCTCCAGAAATCTTACAATCCAGGGCCCTCAGAGCACACCTTCCCCTAGATATCAACTTCAGAGGATGCATGAAGGGCTTCCAGTTCCAAAAGAAGGACTTCAATTTACTGGAGCAGACAGAAACCCTGGGAGTTGGTTATGGATGCCCAGAAGACTCACTTATATCTCGCAGAGCATATTTCAATGGACAGAGCTTCATTGCTTCAATTCAGAAAATATCTTTCTTTGATGGCTTTGAAGGAGGTTTTAATTTCCGAACATTACAACCAAATGGGTTACTATTCTATTATGCTTCAGGGTCAGACGTGTTCTCCATCTCACTGGATAATGGTACTGTCATCATGGATGTAAAGGGAATCAAAGTTCAGTCAGTAGATAAGCAGTACAATGATGGGCTGTCCCACTTCGTCATTAGCTCTGTCTCACCCACAAGATATGAACTGATAGTAGATAAAAGCAGAGTTGGGAGTAAGAATCCTACCAAAGGGAAAATAGAACAGACACAAGCAAGTGAAAAGAAGTTTTACTTCGGTGGCTCACCAATCAGTGCTCAGTATGCTAATTTCACTGGCTGCATAAGTAATGCCTACTTTACCAGGGTGGATAGAGATGTGGAGGTTGAAGATTTCCAACGGTATACTGAAAAGGTCCACACTTCTCTTTATGAGTGTCCCATTGAGTCTTCACCATTGTTTCTCCTCCATAAAAAAGGAAAAAATTTATCCAAGCCTAAAGCAAGTCAGAATAAAAAGGGAGGGAAAAGTAAAGATGCACCTTCATGGGATCCTGTTGCTCTGAAACTCCCAGAGCGGAATACTCCAAGAAACTCTCATTGCCACCTTTCCAACAGCCCTAGAGCAATAGAGCACGCCTATCAATATGGAGGAACAGCCAACAGCCGCCAAGAGTTTGAACACTTAAAAGGAGATTTTGGTGCCAAATCTCAGTTTTCCATTCGTCTGAGAACTCGTTCCTCCCATGGCATGATCTTCTATGTCTCAGATCAAGAAGAGAATGACTTCATGACTCTATTTTTGGCCCATGGCCGCTTGGTTTACATGTTTAATGTTGGTCACAAAAAACTGAAGATTAGAAGCCAGGAGAAATACAATGATGGCCTGTGGCATGATGTGATATTTATTCGAGAAAGGAGCAGTGGCCGACTGGTAATTGATGGTCTCCGAGTCCTAGAAGAAAGTCTTCCTCCTACTGAAGCTACCTGGAAAATCAAGGGTCCCATTTATTTGGGAGGTGTGGCTCCTGGAAAGGCTGTGAAAAATGTTCAGATTAACTCCATCTACAGTTTTAGTGGCTGTCTCAGCAATCTCCAGCTCAATGGGGCCTCCATCACCTCTGCTTCTCAGACATTCAGTGTGACCCCTTGCTTTGAAGGCCCCATGGAAACAGGAACTTACTTTTCAACAGAAGGAGGATACGTGGTTCTAGATGAATCTTTCAATATTGGATTGAAGTTTGAAATTGCATTTGAAGTCCGTCCCAGAAGCAGTTCCGGAACCCTGGTCCACGGCCACAGTGTCAATGGGGAGTACCTAAATGTTCACATGAAAAATGGACAGGTCATAGTGAAAGTCAATAATGGCATCAGAGATTTTTCCACCTCAGTTACACCCAAGCAGAGTCTCTGTGATGGCAGATGGCACAGAATTACAGTTATTAGAGATTCTAATGTGGTTCAGTTGGATGTGGACTCTGAAGTGAACCATGTGGTTGGACCCCTGAATCCAAAACCAATTGATCACAGGGAGCCTGTGTTTGTTGGAGGTGTTCCAGAATCTCTACTGACACCACGCTTGGCCCCCAGCAAACCCTTCACAGGCTGCATACGCCACTTTGTGATTGATGGACACCCAGTGAGCTTCAGTAAAGCAGCCCTGGTCAGCGGCGCCGTAAGCATCAACTCCTGTCCAGCAGCCTGACATGACAGAGCACAGCTGCCCAAATACAAAGTTCTTTAGAGCACTGAAAGAAACACAAAGCCAGCCAGGAGGAACAGTAACTCTTCCTTCGGGTGGAAGCTTTCATCGAGTTGAACAGGACTTAAACGAATCATCAGGGACCGGATATTTCTTATTTCTCATTTGGATTCTTAACCTTGAATCCAAAGTGTCTGCAATGGACAACAATTGAAGGAGTGGCAAACTTACTTGTATTGAGAGCACACGCAATTCCTACTGGTGAAATTACTGTTTCTGTTTCTAATAAAATAGAAGGGATTCCAAATAAACACTTGCACACATTTTTGAAGTGCGGCTAGATTCTCAGATTCACCTTTCTTCCAGGGAAGATAACTTTCAATCTATATAAAAATCTCTGTCCTAAAACTACCTTTCTTTATTTTGAAGAGACTTACTAACTTACATATAATCTAAATTAGATGATAGATTTGTTTTTAGCCCTTTTGTTTGGTCTATCAGTATAAGAAGAATATTTTAGGTTTATAGCTGAAGTTATCAAGGTTTAATAAAGTAAATTTCTAACAGAATACTAGAAAAATGCAGTATAATTTAATTTTTTCTAAATAAGAAACACAGGAAATCAACTACTTTTTCCCCTTCCTTATCTCCTTAAAAGAAAAATAAAATTGTACATGAGAGGAGGCTTCTGTAGGTTATTATTACCATTATTGTGTGTTCTATGGGAATCATTGAGGATATCACAGCAAAAACAGTAGGACAAAATCATAAAATTCAATTTAAGAGTACACAAGTCCTTTTATTAAAAGTTTGCTCCTAGCCTGGGCAACATAATGAGATCCCATCTCTGC