Transcript asmbl_146379

Sequence
Transcript Sequence for observation asmbl_146379 of TGE0056398:
GAGGGCTCCTCTTAGGAAGTTATTTAAGAGCCAACTGTCTTGTCTTTCCCGAGTCCGTTTGAGGAAGTCCCCGAGGCGCACAGAGCAAGCCCACGCGAGGGCACCTCTGGAGGGGAGCGCCTGCAGGACCTTGTAAAGTCAAAAATGTCAGAAACTTCCAGGACCGCCTTTGGAGGCAGAAGAGCAGTTCCACCCAATAACTCTAATGCAGCGGAAGATGACCTGCCCACAGTGGAGCTTCAGGGCGTGGTGCCCCGGGGCGTCAACCTGCAAGAGTTTCTTAATGTCACGAGCGTTCACCTGTTCAAGGAGAGATGGGACACTAACAAGGTGGACCACCACACTGACAAGTATGAAAACAACAAGCTGATTGTCCGCAGAGGGCAGTCTTTCTATGTGCAGATTGACTTCAGTCGTCCATATGACCCCAGAAGGGATCTCTTCAGGGTGGAATACGTCATTGGTCGCTACCCACAGGAGAACAAGGGAACCTACATCCCAGTGCCTATAGTCTCAGAGTTACAAAGTGGAAAGTGGGGGGCCAAGATTGTCATGAGAGAGGACAGGTCTGTGCGGCTGTCCATCCAGTCTTCCCCCAAATGTATTGTGGGGAAATTCCGCATGTATGTTGCTGTCTGGACTCCCTATGGCGTACTTCGAACCAGTCGAAACCCAGAAACAGACACGTACATTCTCTTCAATCCTTGGTGTGAAGATGATGCTGTGTATCTGGACAATGAGAAAGAAAGAGAAGAGTATGTCCTGAATGACATCGGGGTAATTTTTTATGGAGAGGTCAATGACATCAAGACCAGAAGCTGGAGCTATGGTCAGTTTGAAGATGGCATCCTGGACACTTGCCTGTATGTGATGGACAGAGCACAAATGGACCTCTCTGGAAGAGGGAATCCCATCAAAGTCAGCCGTGTGGGGTCTGCAATGGTGAATGCCAAAGATGACGAAGGTGTCCTCGTTGGATCCTGGGACAATATCTATGCCTATGGCGTCCCCCCATCGGCCTGGACTGGAAGCGTTGACATTCTATTGGAATACCGGAGCTCTGAGAATCCAGTCCGGTATGGCCAATGCTGGGTTTTTGCTGGTGTCTTTAACACATTTTTACGATGCCTTGGAATACCAGCAAGAATTGTTACCAATTATTTCTCTGCCCATGATAATGATGCCAATTTGCAAATGGACATCTTCCTGGAAGAAGATGGGAACGTGAATTCCAAACTCACCAAGGATTCAGTGTGGAACTACCACTGCTGGAATGAAGCATGGATGACAAGGCCTGACCTTCCTGTTGGATTTGGAGGCTGGCAAGCTGTGGACAGCACCCCCCAGGAAAATAGCGATGGCATGTATCGGTGTGGCCCCGCCTCGGTTCAAGCCATCAAGCACGGCCATGTCTGCTTCCAATTTGATGCACCTTTTGTTTTTGCAGAGGTCAACAGCGACCTCATTTACATTACAGCTAAGAAAGATGGCACTCATGTGGTGGAAAATGTGGATGCCACCCACATTGGGAAATTAATTGTGACCAAACAAATTGGAGGAGATGGCATGATGGATATTACTGATACTTACAAATTCCAAGAAGGTCAAGAAGAAGAGAGATTGGCCCTAGAAACTGCCCTGATGTACGGAGCTAAAAAGCCCCTCAACACAGAAGGTGTCATGAAATCAAGGTCCAACGTTGACATGGACTTTGAAGTGGAAAATGCTGTGCTGGGAAAAGACTTCAAGCTCTCCATCACCTTCCGGAACAACAGCCACAACCGTTACACCATCACAGCTTATCTCTCAGCCAACATCACCTTCTACACCGGGGTCCCGAAGGCAGAATTCAAGAAGGAGACGTTCGACGTGACGCTGGAGCCCTTGTCCTTCAAGAAAGAGGCGGTGCTGATCCAAGCCGGCGAGTACATGGGTCAGCTGCTGGAACAAGCGTCCCTGCACTTCTTTGTCACAGCTCGCATCAATGAGACCAGGGATGTTCTGGCCAAGCAAAAGTCCACCGTGCTAACCATCCCTGAGATCATCATCAAGGTCCGTGGCACTCAGGTAGTTGGTTCTGACATGACTGTGACAGTTGAGTTTACCAATCCTTTAAAAGAAACCCTGCGAAATGTCTGGGTACACCTGGATGGTCCTGGAGTAACAAGACCAATGAAGAAGATGTTCCGTGAAATCCGGCCCAACTCCACCGTGCAGTGGGAAGAAGTGTGCCGGCCCTGGGTCTCTGGGCATCGGAAGCTGATAGCCAGCATGAGCAGTGACTCCCTGAGACATGTGTATGGCGAGCTGGACGTGCAGATTCAAAGACGACCTTCCATGTGAATGCACAGGAAGCTGAGATGAACCCTGGCATTTGGCCTCTTGTAGTCTTGGCTAAGGAAATTCTAACGCAAAAATAGCTCTTGCTTTGACTTAGGTGTGAAGACCCAGACAGGACTGCAGAGGGCTCCAGAGTGGAGATCCCACATATTTCAAAAACATGCTTTTCCAAACCCAGGCTATTCGGCAAGGAAGTTAGTTTTTAATCTCTCCACCTTCCAAAGAGTGCTAAGCATTAGCTTTAATTAAGCTCTCATAGCTCATAAGAGTAACAGTCATCATTTATCATCACAAATGGCTACATCTCCAAATATCAGTGGGCTCTCTTACCAGGGAGATTTGCTCAATACCTGGCCTCATTTAAAACAAGACTTCAGATTCCCCACTCAGCCTTTTGGGAATAATAGCACATGATTTGGGCTCTAGAATTCCAGTCCCCTTTCTCGGGGTCAGGTTCTACCCTCCATGTGAGAATATTTTTCCCAGGACTAGAGCACAACATAATTTTTATTTTTGGCAAAGCCAGAAAAAGATCTTTCATTTTGCACCTGCAGCCAAGCAAATGCCTGCCAAATTTTAGATTTACCTTGTTAGAAGAGGTGGCCCCATATTAACAAATTGCATTTGTGGGAAACTTAACCACCTACAAGGAGATAAGAAAGCAGGTGCAACACTCAAGTCTATTGAATAATGTAGTTTTGTGATGCATTTTATAGAATGTGTCACACTGTGGCCTGATCAGCAGGAGCCAATATCCCTTACTTTAACCCTTTCTGGGATGCAATACTAGGAAGTAAAGTGAAGAATTTATCTCTTTAGTTAGTGATTATATTTCACCCATCTCTCAGGAATCATCTCCTTTGCAGAATGATGCAGGTTCAGGTCCCCTTTCAGAGATATAATAAGCCCAACAAGTTGAAGAAGCTGGCGGATCTAGTGACCAGATATATAGAAGGACTGCAGCCACTGATTCTCTCTTGTCCTTCACATCACCCATGTTGAGACCTCAGCTTGGCACTCAGGTGCTGAAGGGTAATATGGACTCAGCCTTGCAAATAGCCAGTGCTAGTTCTGACCCAACCACAGAGGATGCTGACATCATTTGTATTATGTTCCAAGGCTACTACAGAGAAGGCTGCCTGCTATGTATTTGCAAGGCTGATTTATGGTCAGAATTTCCCTCTGATATGTCTAGGGTGTGATTTAGGTCAGTAGACTGTGATTCTTAGCAAAAAATGAACAGTGATAAGTATACTGGGGGCAAAATCAGAATGGAATGCTCTGGTCTATATAACCACATTTCTAAGCCTTTGAGACTGTTCCTGAGCCTTCAGCACTAACCTATGAGGGTGAGCTGGTCCCCTCTATATATACATCATACTTAACTTTACTAAGTAATCTCACAGCATTTGCCAAGTCTCCCAATATCCAATTTTAAAATGAAATGCATTTTGCTAGACAGTTAAACTGGCTTAACTTAGTATATTATTATTAATTACAATGTAATAGAAGCTTAAAATAAAGTTAAACTGATTATATTTGCATCTGTGC