Transcript asmbl_138056

Sequence
Transcript Sequence for observation asmbl_138056 of TGE0057571:
GCATTGTGGGAAGCCGGCCGCGAGGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGCCGCGCGGGCGGGAAGCGAAGAGGCGGGCGGGCCAGCGAGGAGCGCGGAGAGAAAAGGCGCGAGCGGCCAGGAGGGCTCAGGCCGAGACACCTTGCAGCTGCCGCCGCCGCCACCGAGCCGCCGCTGTGCTCACTGATCCGCCTCCAGGGCCACCGCCATGTCGAGCCGCGGTGGGAAGAAGAAGTCCACCAAGACGTCCAGGTCTGCCAAAGCAGGAGTCATCTTTCCCGTGGGGCGGATGCTGCGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCACCCGTGTACATGGCCGCCGTCCTGGAATACCTGACAGCGGAGATTCTGGAGCTGGCTGGCAATGCAGCGAGAGACAACAAGAAGGGACGGGTCACACCCCGGCACATCCTGCTGGCTGTGGCCAATGATGAAGAGCTGAATCAGCTGCTAAAAGGAGTCACCATAGCCAGTGGGGGTGTGTTACCCAACATCCACCCCGAGTTGCTAGCGAAGAAGCGGGGATCCAAAGGAAAGTTGGAAGCCATCATCACACCACCCCCAGCCAAAAAGGCCAAGTCTCCATCCCAGAAGAAGCCTGTATCTAAAAAAGCAGGAGGCAAGAAAGGGGCCCGGAAATCCAAGAAGCAGGGTGAAGTCAGTAAGGCAGCCAGCGCCGACAGCACAACCGAGGGCACACCTGCCGACGGCTTCACAGTCCTCTCCACCAAGAGCCTCTTCCTTGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACAGTGATGCTGTCGTTCACCCGACAAACACTGACTTCTACATCGGTGGTGAAGTAGGAAACACGCTGGAGAAGAAAGGTGGCAAGGAGTTTGTGGAAGCTGTCCTGGAACTCCGGAAAAAGAACGGGCCCTTGGAAGTAGCTGGAGCTGCTGTCAGCGCAGGCCATGGCCTGCCTGCCAAGTTTGTGATCCACTGTAATAGTCCAGTTTGGGGTGCAGACAAGTGTGAAGAACTTCTGGAAAAGACAGTGAAAAACTGCTTGGCCCTGGCTGATGATAAGAAGCTGAAATCCATTGCATTTCCATCCATCGGCAGCGGCAGGAACGGTTTTCCAAAGCAGACAGCAGCTCAGCTGATTCTGAAGGCCATCTCCAGTTACTTCGTGTCTACAATGTCCTCTTCCATCAAAACGGTGTACTTCGTGCTTTTTGACAGCGAGAGTATAGGCATCTATGTGCAGGAAATGGCCAAGCTGGACGCCAACTAGGCTGAGCAATGACAGAACCAGCTGCACCATGTACCCCACCTTCAGTTTAAAAGAAAAAAAAAATCCCCTTCACTCCTACTGGGAGGTGGGACCCCTTTCATTTTCAGTTTTGCTCATCTAGGGAAAATAAGGCTTTGGTTTCCAGTTTAATTGTTTTTGACCTTCTAAAATGTTTTTATGTTAGCACTGATAGTTGGCATTACTGTTGTTAAGCACTGTGTTCCAGACCGTGTCTGACTTAGTGTAACCTAGGAGATTTTATAGTTTTATTTTAATGAAACCCTGATTGACGCACAGCAGTGGGGAGAACAGCGTCTTTTACCTGTCACCGAAGCCAGGAAGCCCCGTTTGTAAGCGTGTGTTGTGGTGCTTTATTGTACATCCTCCAGTGGCGTTCTTTTTACTCTAATGTTCTTTTGGTTTCCCCCCTCAGAAGAATCATGAATTTGCAACAGACCTAATTTTTGGTTACTTTTTGTCTTATTGATGGATTTGAAAATGAAAGATTTAATAAGGCAAAGCAGAATCTGTTGTCCTTAATTATATTTGCAATTTGGAATTTGTGTGAGTTGATTTAGTAAAATGTTAAACCGTTGTTGTGACTGGTGTGTTCCAGTTATTGTGCCCGTGAG