Transcript asmbl_13042

Sequence
Transcript Sequence for observation asmbl_13042 of TGE0061202:
CAGACCCACGGCTCGCTGCTGCGGCTGCACCAGGTGACCCCGGCCGACTCAGGCGAGTATGTGTGCCATGTGGTGGGCACCTCCGGCCCCCTAGAGGCCTCAGTCCTGGTCACCATCGAAGCCTCTGGCTCAAGTGCTGTCCACGTCCCCGCCCCAGGTGGAGCCCCACCCATCCGCATCGAGCCCTCCTCCTCCCGAGTGGCAGAAGGGCAGACCCTGGATCTGAAGTGCGTGGTGCCCGGGCAGGCCCACGCCCAGGTCACGTGGCACAAGCGTGGAGGAAACCTCCCTGCCCGGCACCAGGTCCACGGCCCACTGCTGAGGCTGAACCAGGTGTCCCCGGCTGACTCTGGCGAGTACTCGTGCCAAGTGACCGGAAGCTCAGGCACCCTGGAGGCATCTGTCCTGGTCACAATTGAGCCCTCCAGCCCAGGACCCATTCCTGCTCCAGGACTGGCCCAGCCCATCTACATCGAGGCCTCCTCTTCACACGTGACTGAAGGGCAGACTCTGGATCTGAACTGTGTGGTGCCCGGGCAGGCCCATGCCCAGGTCACGTGGTACAAGCGCGGGGGCAGCCTCCCCGCCCGGCACCAGACCCATGGCTCCCAGCTGCGGCTCCACCTCGTCTCCCCTGCCGACTCAGGCGAGTATGTGTGTCGTGCAGCCAGCGGCCCAGGCCCTGAGCAAGAAGCCTCCTTCACAGTCACCGTCCCGCCCAGTGAGGGGTCTTCCTACCGCCTTAGGAGCCCGGTCATCTCCATCGACCCGCCCAGCAGCACCGTGCAGCAGGGCCAGGATGCCAGCTTCAAGTGCCTCATCCATGACGGGGCAGCCCCCATCAGCCTCGAGTGGAAGACCCGGAACCAGGAGCTGGAGGACAACGTCCACATCAGTCCCAATGGCTCCATCATCACCATCGTGGGCACCCGGCCCAGCAACCACGGTACCTACCGCTGCGTGGCCTCCAATGCCTACGGTGTGGCCCAGAGTGTGGTGAACCTCAGTGTGCACGGGCCCCCTACAGTGTCCGTGCTCCCCGAGGGCCCCGTGTGGGTGAAAGTGGGAAAGGCTGTCACCCTGGAGTGTGTCAGTGCCGGGGAGCCCCGCTCCTCTGCTCGTTGGACCCGGATCAGCAGCACCCCTGCCAAGTTGGAGCAGCGGACATATGGGCTCATGGACAGCCACGCGGTGCTGCAGATTTCATCAGCTAAACCATCAGATGCGGGCACTTATGTGTGCCTTGCTCAGAATGCACTAGGCACAGCACAGAAGCAGGTGGAGGTGATCGTGGACACGGGCGCCATGGCCCCAGGGGCCCCTCAGGTCCAAGCTGAAGAAGCTGAGCTGACTGTGGAGGCTGGACACACGGCCACCTTGCGCTGCTCAGCCACAGGCAGCCCCGCGCCCACCATCCACTGGTCCAAGCTGCGTTCCCCACTGCCCTGGCAGCACCGGCTGGAAGGTGACACACTCATCATACCCCGGGTAGCCCAGCAGGACTCGGGCCAGTACATCTGCAATGCCACTAGCCCTGCTGGGCACGCTGAGGCCACCATCATCCTGCACGTGGAGAGCCCACCATATGCCACCACGGTCCCAGAGCACGCTTCGGTGCAGGCAGGGGAGACGGTGCAGCTCCAGTGCCTGGCTCACGGGACACCCCCACTCACCTTCCAGTGGAGCCGCGTGGGCAGCAGCCTTCCTGGGAGGGCGACCGCCAGGAACGAGCTGCTGCACTTTGAGCGTGCAGCCCCTGAGGACTCAGGCCGCTACCGCTGCCGGGTCACCAACAAGGTGGGCTCAGCCGAGGCCTTTGCCCAGCTGCTCGTCCAAGGCCCTCCCGGCTCTCTCCCTGCCACCTCCATCCCAGCAGGGTCCACGCCCACCGTGCAGGTCACGCCTCAGCTAGAGACCAAGAGCATTGGGGCCAGCGTTGAGTTCCACTGTGCTGTGCCCAGCGACCGGGGTACCCAGCTCCGTTGGTTCAAGGAAGGGGGTCAGCTGCCTCCGGGTCACAGCGTGCAGGATGGGGTGCTCCGAATCCAGAACTTGGACCAGAGCTGCCAAGGGACGTATATATGCCAGGCCCATGGACCTTGGGGGAAGGCCCAGGCCAGTGCCCAGCTGGTTATCCAAGCCCTGCCCTCGGTGCTCATCAACATCCGGACCTCTGTGCAGACCGTGGTGGTTGGCCACGCCGTGGAGTTCGAATGCCTGGCACTGGGTGACCCCAAGCCTCAGGTGACATGGAGCAAAGTTGGAGGGCACCTGCGGCCAGGCATTGTGCAGAGCGGAGGTGTCGTCAGGATCGCCCACGTAGAGCTGGCTGATGCGGGACAGTATCGCTGCACTGCCACCAACGCAGCTGGCACCACACAATCCCACGTCCTGCTGCTTGTGCAAGCCTTGCCCCAGATCTCAATGCCCCAAGAAGTCCGTGTGCCTGCTGGTTCTGCAGCTGTCTTCCCCTGCATAGCCTCAGGCTACCCCACTCCTGACATCAGCTGGAGCAAGCTGGATGGCAGCCTGCCACCTGACAGCCGCCTGGAGAACAACATGCTGATGCTGCCCTCAGTCCGACCCCAGGACGCAGGTACCTACGTCTGCACCGCCACTAACCGCCAGGGCAAGGTCAAAGCCTTTGCCCACCTGCAGGTGCCAGGTAAGACACCACCCCTAAGAATTGGCAGTGCCCTGCCCACTCCCTGACTGGCAGGGTCTTCAGCTGTGCTCTCTGCTGGCAGAGCGGGTGGTGCCCTACTTC