Transcript asmbl_13031

Sequence
Transcript Sequence for observation asmbl_13031 of TGE0061198:
CGAGCTGGCCGGCGAGCGGGCGGCTGCGGGCGGCGCGGAGCGGGCGGCGCGGAGCGAGCGAGCGAGAGAGCGGCGCGGGCCGGGCCATGGGGTGGCGGGCGGCGGGCGCGCTGCTGCTGGCGCTGCTGCTGCACGGGCGGCTGCTGGCGGTGACCCATGGGCTGAGGGCATACGATGGCTTGTCTCTGCCTGAGGACATAGAGACCGTCACAGCAAGCCAAATGCGCTGGACACATTCGTACCTTTCTGATGATGAGGACATGCTGGCTGACAGCATCTCAGGAGACGACCTGGGCAGTGGGGACCTGGGCAGCGGGGACTTCCAGATGGTTTATTTCCGAGCCCTGGTGAATTTCACTCGCTCCATCGAGTACAGCCCTCAGCTGGAGGATGCAGGCTCCAGAGAGTTCCGAGAGGTGTCCGAGGCTGTGGTAGACACGCTGGAGTCGGAGTACTTGAAAATTCCCGGAGACCAGGTTGTCAGTGTGGTGTTCATCAAGGAGCTGGATGGCTGGGTTTTTGTGGAGCTGGATGTGGGCTCGGAAGGGAATGCGGATGGGGCTCAGATTCAGGAGATGCTGCTCAGGGTCATCTCCAGCGGCTCTGTGGCCTCCTACGTCACCTCTCCCCAGGGATTCCAGTTCCGACGCCTGGGCACAGCACAGACCCCCCCACCCCCGCCGGCCGCTGTGGCGGTCGCAGTGACACCAGTGCCCCAGTTCCCAAGAGCCTGCACGGAGGCCGAGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCT