Transcript asmbl_110845

Sequence
Transcript Sequence for observation asmbl_110845 of TGE0057089:
TGGCGATCGGAGCGGAAGTGGAGCTACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTAGTCGCCGCCGCCGCCGCCGCTGCAGCCACTGCAGGCACCGCTGCCGCCGCCTGAGTAGTGGGCTTAGGAAGGAAGAGGTCATCTCGCTCGGAGCTTCGCTCGGAAGGGTCTTTGTTCCCTGCAGCCCTCCCACGGGAATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAAACTCGCTGAGCAGGCTGAGCGATATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGAACAGGGGCATGAACTCTCCAACGAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGTGGTAGGCGCCCGCCGCTCTTCCTGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAGGAATGAGAAGAAGCAGCAGATGGGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCAGGACATCTGCAATGATGTTCTGGAGCTGTTGGACAAATATCTTATTCCCAATGCTACACAACCAGAAAGTAAGGTGTTCTACTTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGAAGTGGCATCTGGAGACAACAAACAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGAAGCATTTGAAATTAGTAAGAAAGAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGCACTAAATTTCTCAGTCTTTTACTATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCTGGCAAAAACGGCATTTGATGAAGCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTATAAAGACAGCACTCTGATCATGCAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGAAAACCAGGGAGACGAAGGAGACGCTGGGGAGGGAGAGAACTAATGTTTCTCGTGCTTTGTGATCTGTTCAGTGTCACTCTGTACCCTCAACATATATCCCTTGTGCGAT