Transcript asmbl_27072

Sequence
Transcript Sequence for observation asmbl_27072 of TGE0000969:
CGGGGCCGCAGGAGGGCGGGGCGCGAGCGAGAGCTGGGAGAAGGCAGTGAGCGAGCAGGCGGCAGGCACGGTCCGTGCGGAGCAGGCGAGCGAGCGGGAAGACGCAGCCACCTTCCTCACCAGCCAGCCCACAGCGGTTTGTTCCCCTTCTCGGGAGTGCGCCAATGCCTGGGCCGACCCAAACCCTGTCCCCAAATGGCGAGAACAACAACGACATCATCCAGGATAATAACGGGACCATCATTCCTTTCCGGAAGCACACAGTGCGCGGGGAGCGTTCCTACAGTTGGGGAATGGCGGTCAATGTGTATTCTACCTCGATAACCCAAGAGACTATGAGCAGACATGACATCATTGCATGGGTTAATGACATAGTATCTTTAAACTACACAAAAGTGGAACAGCTTTGTTCAGGAGCGGCCTATTGCCAATTCATGGACATGCTCTTCCCTGGCTGCATTAGTTTGAAGAAAGTAAAATTTCAAGCAAAGCTGGAACATGAATATATTCACAATTTTAAACTTCTGCAAGCATCATTTAAGCGAATGAACGTTGATAAGGTAATTCCAGTGGAGAAGCTAGTGAAAGGACGTTTCCAGGACAACCTGGATTTTATTCAATGGTTTAAGAAATTCTATGATGCTAACTACGATGGGAAGGAGTATGATCCTGTAGAGGCACGACAAGGGCAAGATGCAATTCCTCCTCCTGACCCTGGTGAACAGATCTTCAACCTGCCAAAAAAGTCTCACCATGCAAACTCCCCCACAGCAGGTGCAGCTAAATCAAGTCCAGCAGCTAAACCAGGATCCACACCTTCTCGACCCTCATCAGCCAAAAGGGCTTCTTCCAGTGGCTCAGCATCCAAATCCGATAAAGATTTAGAAACGCAGGTCATACAGCTTAATGAACAGGTACATTCATTAAAACTTGCCCTTGAAGGCGTGGAAAAGGAAAGGGATTTCTACTTTGGGAAGTTGAGAGAGATCGAGCTACTCTGCCAAGAACACGGGCAGGAAAATGATGACCTCGTGCAGAGACTAATGGACATCCTGTATGCTTCAGAAGAACACGAGGGCCACACAGAAGAGCCGGAAGCAGAGGAGCAAGCCCACGAACAGCAGCCCCCGCAGCAGGAAGAGTACTGACCCACCCCGGCTGCTCTTGACACTTCCATTGTGTGTGGGAACGTTTCTTCTGGAGAATTGGAACATGTGTGGCCCCAAGCTCAACAGAAACCAGTTGTTCCCAATCTGCCGTTACCATCAACGCACTGTTGCATATGCCAGCCACTGCGCTTGGTTCCCATTTTCTTTGCCAAGGTGTATTAGCGGACGGCCCTCTGGCCACCTACCCGAGAGATCGTAGGGTCACATACATCCAACTTCACCACTTGGCTGCTTGAGATTGGTTCTGCTCTTTTCTTCATTTCTTTCCAGAACAACTCTTTCCCACCCCAACACCACTGCCACCACCCCTCTTTTTATCCTGGTGTGAAACAATGGTAATTTGATATATGGTATTTATATTGGCATTTTTCAACCCAGTGTCACTAGATGTCACACACATTTGTGGTGCTTTGATGTTTGCAAGTCTAACCTCTGAACATAAATTTGGTCAAATAATTGGAACAAAGGGAAACAGATACTTGATATGAAAGCCATAATGACGGTGACTTGTGTCGTGGGGGAAAACATAAGGTCATTTTCTCCCTCTACTCACAATACTAAAGGGAAAAAATGGATTCAAAGCTAGGATTTCAGGGCCCAGCAGTGTTCCTCCATCAGCATGTTAGACAACTACACAGTATGTTGTTAGTTTTGAAAGACATTCACTCAAGGAAAACACCATCTCAACTTTGCCCGCTCACCATGTCCCTTGCCCCCATGTAGCCCATTTCCCAGGTTATGCTCTTTTCTTTCTCAGGGTCCTCTTTGGTGGGCAGCCACTCCCCGAGATGTTGCCATCAGTTTTCTGCAGTCCAAAGAGGGTATGGTTAGGTACGGGTCTTCCTGCCTCATTCCTCTTCCTCTTTGTGTAGGTTTCAGCCACAAAACTGTCATTCACTCTAGGGGACCCCTACTAAAGGGTAACTTCAGGTGTGCAGCCCTGAGCTCCAAGGCTCTGCACCATGCCACACACTTGCTGTAAGGCTAGAAGTGAAGACCTTATTAATAGGAGCATAATTGCGAGGGAGAATCATGGTTCTGCAGTCTGGTGTAGACACTGGAATAACAGCACAGAAAAATCTATGACTCCCAATATCTTCTAGAATAAAGAATTTTCCCTCTTTAACACAAGGGCCCTCCTTGTCATTGACCTTAGCTAAACCATGGCAATTCATAAATAGAGGAAACATTAATGAATTAAAAGCATTCCTTATTTTTTAACTAATATTTGTACATTTTCTTAGTCTCTTTCCAAGTCTTTGCCTCTTTTTTTTCTTTATTTTTATTTTTTCCTTTGACAGATGGTATCCCTTCCTGGAT