Transcript asmbl_96598

Sequence
Transcript Sequence for observation asmbl_96598 of TGE0057459:
CCTGGTTCCGCGCGCCGGAGCGCGCTAGCCGCATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGCACGCGGTCGGCTACGCGCTGCTGGCGCTGAAGGAAGTGGAGGAGATCAGTCTGCTGCAGCCGCAGGTGGAGGAGTCTGTGCTCAACCTGGGCAAATTCCACAGCATCGTTCGTCTGGTGGCCTTTTGTCCCTTTGCCTCATCCCAGGTTGCCTTGGAAAATGCCAACGCCGTGTCTGAAGGGGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACCCACCTGCCGTCCAAAAAGAAGAAAGTACTCTTGGGAGTTGGGGATCCCAAGATTGGTGCCGCAATACAGGAGGAGTTAGGGTACAACTGCCAGACTGGAGGAGTCATAGCTGAGATCCTGCGAGGAGTTCGTCTGCACTTCCACAATCTGGTGAAGGGTCTGACCGATCTGTCAGCTTGTAAAGCACAGCTGGGGCTGGGACACAGCTATTCCCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATCATCCAGTCCATTAGCCTCCTGGACCAGCTGGATAAGGACATCAATACCTTCTCTATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCGGAGCTGGTGAAGATCATCAACGACAATGCCACATACTGCCGTCTTGCCCAGTTTATTGGAAACCGAAGGGAACTGAATGAGGACAAGCTGGAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCACGGTCCTCCATGGGCATGGACATATCTGCCATTGACTTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTATCTGAATACCGCCAGAGCCTACACACTTACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGTGCACGTCTCATCGCACATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGAGCCCTGAAGACAAGGGGTAACACTCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATCGATTGCTTCTCTGAGGTGCCCACGAGTGTATTCGGGGAGAAGCTTCGAGAACAAGTTGAAGAGCGACTGTCCTTCTATGAGACTGGAGAGATACCACGAAAGAATCTGGATGTCATGAAGGAAGCAATGGTTCAGGCAGAGGAAGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTAAAGAAGGAAAAGAAACGGCTGGCTGCACTTGCCCTCGCGTCTTCAGAAAACAGCAGTAGTACTCCAGAGGAGTGTGAGGAGATGAGTGAAAAACCCAAAAAGAAGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCCATCTATCTCTTTCTCCAAACCCAAGAAAAAGAAATCTTTTTCCAAGGAGGAGTTGATGAGTAGCGATCTTGAAGAGACCGCTGGCAGCACCAGTATTCCCAAGAGGAAGAAGTCTACACCCAAGGAGGAAACAGTTAATGACCCTGAGGAGGCAGGCCACAGAAGTGGCTCCAAGAAAAAGAGGAAATTCTCCAAAGAGGAGCCGGTCAGCAGTGGGCCTGAAGAGGCGGTTGGCAAGAGCAGCTCCAAGAAGAAGAAAAAGTTCCATAAAGCATCCCAGGAAGATTAGAATGCAAATGGACATTCTCTGGGAGGTGGGGCATACCATAGCCCAAGGTGACATTTCCCACCCTGTGCCGTGTTCCCCAATAAAAACAAATTCACA