Transcript asmbl_33247

Sequence
Transcript Sequence for observation asmbl_33247 of TGE0004925:
GTCCCCGCCTCCTCCAGTGCCTCCACTCCCCGCTACCCAGGAAGGCCGTGTGGGTTACGCGCGCTGCTTTCGCTTTCCCTTGGCGGTGCCCACTCCTCGCTCCTCGTGAGGCGCTAGGCCCCCTGCCCCTGCCATGGCCATGCTCAGGGTCCAGCCTGAAGCCCAAGCCAAGGTCGATGTGTTCCGTGAAGACCTGTGTACCAAGACAGAGAACCTGCTCGGAAGCTATTTCCCCAAGAAGATTTCTGAGTTGGATGCATTTTTAAAGGAGCCAGCACTCAATGAAGCCAGCCTGAGCAATCTGAAAGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAAAAAGGGGAAGACGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAGAAGATTGTGATCCTTCTACAGCGCCTAAAGCCTGAAATCAAGGATGTCATTGAGCAACTTAACCTCGTCACCACCTGGTTGCAGCTGCAGATCCCTCGGATTGAGGATGGAAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCGCCCTTCACACCAAGCTGGAAGGCTTTCACACTCAAATCTCCAAGTATTTCTCTGAGCGGGGTGATGCCGTGACCAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGAAATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGAGAGCCTTTTCTCATACTGTGATGGGTCCAGCAGAGACCTTCCTATCTTCGACAGGGCACTCCAAACTTTGTCCCACCTTCCACCTATTGAGTTCTCTTCCCCTCCCCAACCCCCTTGCCTCCTAGGCACAATAAATAGAGTCCTAGTGGTA