Transcript asmbl_83019

Sequence
Transcript Sequence for observation asmbl_83019 of TGE0001383:
GCTGAGTCCTGGCCTTGCGTCGCACTGTCTGTCCTCAGCTCGCGTAGCCGCGCTCGCGACTCCCTTTCCCGGCATGCCAGGCGGTGCGGCCGCCCTCTGGGCCGTGTAAAGGCCCCTCGGTCTAAGGCTTCCCTATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCCTATCTCATTCCTTTCTTTCGATTACCCGTGGCGCGGAGAGTCAGGGCGGCGGCTGCGGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGTCTTGCCTTCTTCTTAGGTTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGACGGGAAAACAATCAAGCTTCAAATATGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAATGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAATTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCGAAGGAATTTGCTGATTCCCTTGGAATTCCGTTTTTGGAAACCAGTGCTAAGAATGCAACGAATGTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCCGGAGCAACAGCTGGTGGTGCTGAGAAGTCCAATGTTAAAATTCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGTTGCTGCTAAAATTTGCCTCCATCCTTTTCTCACAGCAATGAATTTGCAATCTGAACCCAAGTGAAAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTCTCCACAAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTATTCCCTTGACTCAAGACAGCTAACTTCATTTTCAGAACTGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGACTGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTATATTGGCATGTTTAGATGTCAGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAAACAGCACAAGCAGTGTCTGTCACTTTCCATGCATAAAGTTTAGTGAGATGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTTGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACTGTATGGTGATAAGTATTGTTTTGATTCTTATGGTTAAAGGGAAATAGAGCCTTGCATTATATTCAACACAGCCATTTGTGTGTGCACAATGCAAACTAAGGTATTCTAGACCTATCTTAGAGCAGCATCCAGTATTTGCTTTCTAGATAATATGCCCAATAACATGACCTAGAGGGGCTTCTGTGCTGTGTAGGGATTTAACCAACTTCAGTGGTTCAGGGAGCTCAAACTATATGTAAAACAAGTTTAGAATGTATGCTATCTAGCCCGTTATCTCTGATCCTTCTCTAAAACCATTTGAAATAGCTTCATTGATCAACATTTCATAAATGCATCTGTGGTAGAGGTAGAAAGCAGCACCTTTCCTAATTGGCAAATGATCAGACTAATGTGTGCTAATGTTTTTCTTCCATGCTTTCAGTCAGATTCAACTATTTTATCCTCCACAGTTGCTTAACTTGGTGTTGGAGGAGGGTTTAAGCATTAAGATAGGAAGCAGGAAATTTGATTGCTCTAAATTTAGAAATTATATCCCTAAAAATTAAAACATGAATACTGGGTGGTAATGATAATTGAGGCAAATGTATTTATTTTGGTGACATTTTGCATATATGAAGATTTTCTGAAATAGGACCTTCAAGATCCTAGGGGGTTTTGTTTGGTTTTTAATTGTGAGGAATAAAAAATCTTCTGCCCACACTGGCATTTTAAGGTGACTGAGGTCAAACGTTGTTTCCTTAGGTTGAAATAGCAGCCAAAACATTCTTCACGCAGGGGCTTGGGATATGGCTGCTGGCAACACATTTTGTTGTGGGCTCCTTAATTTAATGATAAAATTTAAGCTAAACACAAGCCAAAAATGAATAGGTTTTTTTAATTTTTATTTTTCACTAAACAGGCAATTGAAATACATGGTACAAAAATAAGTGGTAAGATAATTGTAAAATGAAATGGACAGAATATTCAATTTTCCATCTATGAAAATTTCACAATAAAAATCATAGTTTACTTTGTATTAT