Transcript asmbl_82573

Sequence
Transcript Sequence for observation asmbl_82573 of TGE0001355:
CGGCCGCGTGTGCGGGAGACAAAAGCGGGCGGCGGGCCGCATTGTCTGACGGCGCTCCCTCTCTGCTTTTTGTTCTCGCCTCGCCGCCCCGCCCCTCCGCAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGCGCTCGCCCTCGCTCTCCTCGCCCTCCGCCCCGGCCCCGGCCCCGCGCCCGCCATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCAGTGACCGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCCGTGGCCTACAAGAACGTGGTCGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCTAGCATCGAGCAGAAGACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCCGAGCTGAGATCCATCTGCACCACGGTGCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGTGATTACTTCCGGTACCTTGCTGAAGTTGCGTGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCATTTGATATAAGCAAGAAAGAGATGCAACCCACACACCCAATCCGCCTGGGGCTTGCTCTTAACTTTTCTGTATTTTACTATGAGATTCTTAATAACCCAGAGCTTGCCTGCACGCTGGCTAAAACGGCTTTTGATGAGGCCATTGCTGAACTTGATACACTGAATGAAGACTCATACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACACTTTGGACATCAGACAGTGCAGGAGAAGAATGTGATGCGGCAGAAGGGGCTGAAAACTAAATCCATACAGGGTGTCATCCTTCTTTCCTTCAAGAAACCTTTTTACACATCTCCATTCCTTATTCCACTTGGATTTCCTATAGCAAAGAAACCCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTTCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCTGGTGTGCAGTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATAAACATAAGTAACTCCCAAACACTTATGTAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAAATAAGAAAATGTAGTTAATTACAATTTAAAGAGTATTCCACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTCGGGGGTTTCCTTTCAGTAAGCAACTTTTCCATGCTCTTAATGTATTCCTTTTTAGTAGGAATCCGGAAGTATTAGATTGAATGGAAAAGCACTTGCCATCTCTGTCTAGGGGTCACAAATTGAAATGGCTCCTGTATCACATACGGAGGTCTTGTGTATCTGTGGCAACAGGGAGTTTCCTTATTCACTCTTTATTTGCTGCTGTTTAAGTTGCCAACCTCCCCTCCCAATAAAAATTCACTTACACCTCCTGCCTTTGTAGTTCTGGTATTCACTTTACTATGTGATAGAAGTAGCATGTTGCTGCCAGAATACAAGCATTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAAGTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACCCATATTTTAAGGGACAGGTGAATTTACTACTTTCTAAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTAGTGATACCTATATTTCCACATTGTGCATTGTGACACACTTGTCTAGGGATGCCTGGAAGTGTATAAAATTGGACTGCATTTCTTAGAGTGTTTTACTATAGATCAGTCTCATGGGCCATCTCTTCCTCAGATGTAAATGATATCTGGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAG