Transcript asmbl_82084

Sequence
Transcript Sequence for observation asmbl_82084 of TGE0001332:
GCCGGGGGCTGGGCGGGGACCGGGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCTTCGGGGGCCAGCCGCCGCCATGATCCTGCTGGAGGTGAACAACCGCATCATCGAGGAGACGCTCGCGCTCAAGTTCGAGAACGCGGCCGCCGGAAACAAACCGGAAGCAGTAGAAGTAACATTTGCAGATTTCGATGGGGTCCTCTATCATATTTCAAATCCTAATGGAGACAAAACAAAAGTGATGGTCAGTATTTCTTTGAAATTCTACAAGGAACTTCAGGCACATGGTGCTGATGAGTTATTAAAGAGGGTGTACGGGAGTTTCTTGGTAAATCCAGAATCAGGATACAATGTCTCTTTGCTATATGACCTTGAAAATCTTCCGGCATCCAAGGATTCCATTGTGCATCAAGCTGGCATGTTGAAGCGAAATTGTTTTGCCTCTGTCTTTGAAAAATACTTCCAATTCCAAGAAGAGGGCAAGGAAGGAGAGAACAGGGCAGTTATCCATTATAGGGATGATGAGACCATGTATGTTGAGTCTAAAAAGGACAGAGTCACAGTAGTCTTCAGCACAGTGTTTAAGGATGACGACGATGTGGTCATTGGAAAGGTGTTCATGCAGGAGTTCAAAGAAGGACGCAGAGCCAGCCACACAGCCCCACAGGTCCTCTTTAGCCACAGGGAACCTCCTCTGGAGCTGAAAGACACAGACGCCGCTGTGGGTGACAACATTGGCTACATTACCTTTGTGCTGTTCCCTCGTCACACCAATGCCAGTGCTCGAGACAACACCATCAACCTGATCCACACGTTCCGGGACTACCTGCACTACCACATCAAGTGCTCTAAGGCCTATATTCACACACGTATGCGGGCGAAAACGTCTGACTTCCTCAAGGTGCTGAACCGCGCACGCCCAGATGCCGAGAAAAAAGAAATGAAAACAATCACGGGGAAGACGTTTTCATCCCGCTAATCTTGGGAATAAGAGGAGGAAGCGGCTGGCAACTGAAGGCTGGAACACTTGCTACTGGATAATCGTAGCTTTTAATGTTGCGCCTCTTCAGGTTCTTAAGGGATTCTCCGTTTTGGTTCCATTTTGTACACGTTTGGAAAATAATCTGCAGAAACGAGCTGTGCTTGCAAAGACTTCATAGTTCCCAAGAATT