Transcript asmbl_81984

Sequence
Transcript Sequence for observation asmbl_81984 of TGE0060458:
GAAGGAGTAGCGCGTTCGTGCGTCCTAGTTCCAGTACAGCGTGGAGGGTTTAGGCAGCGTGTTCTGATTCTTTGCGGGACGGCGAGCGCATTTGTGCTTTGCCCGCCGCGGCCTAGGAGGCCTTTTGAGGCCGCGTAGTCGGTGTTTTTGAACTGACTCTACAGCTTCTGGCAGGCCGTGCGGCGCCCTGACCCGGCCTCACCATGTTGGTGCTGTTTGAAACGTCTGTGGGTTACGCCATCTTTAAGGTTCTAAATGAGAAGAAACTTCAAGAGGTTGATAGTTTATGGAAAGAATTTGAAACTCCAGAGAAAGCAAACAAAATAGTAAAGCTAAAACATTTTGAGAAATTTCAGGATACAGCAGAAGCATTAGCAGCATTCACAGCTCTGATGGAGGGCAAAATCAATAAGCAGCTGAAAAAAGTTCTGAAGAAAATAGTAAAAGAAGCCCATGAACCGCTGGCAGTAGCTGATGCTAAACTAGGAGGGGTCATAAAGGAAAAGCTGAATCTCAGTTGTATCCATAGTCCTGTTGTTAATGAACTTATGAGAGGAATTCGTTCACAAATGGATGGATTAATCCCTGGGGTAGAACCACGTGAAATGGCAGCTATGTGTCTTGGATTGGCTCACAGCCTGTCTCGATATAGATTGAAGTTTAGCGCTGATAAAGTAGACACAATGATTGTTCAGGCAATTTCCTTGTTAGATGACTTGGATAAAGAACTAAACAACTACATTATGCGATGTAGAGAATGGTATGGCTGGCATTTCCCTGAATTAGGAAAAATTATTTCAGATAATTTAACATACTGCAAGTGTTTACAGAAAGTTGGCGATAGGAAGAACTATGCCTCTGCCAAGCTTTCTGAGTTGCTGCCAGAAGAAGTTGAAGCAGAAGTGAAAGCAGCTGCAGAGATATCAATGGGAACAGAGGTTTCAGAAGAAGATATTTGCAATATTCTGCATCTTTGCACCCAGGTGATTGAAATCTCTGAATATCGAACCCAGCTCTATGAATATCTACAAAATCGAATGATGGCCATTGCACCCAATGTTACAGTCATGGTTGGGGAATTAGTTGGAGCACGGCTTATTGCTCATGCAGGTTCTCTTTTAAATTTGGCCAAGCATGCAGCTTCTACCGTTCAGATTCTTGGAGCTGAAAAGGCACTTTTCAGAGCCCTCAAATCTAGACGGGATACCCCTAAGTATGGTCTCATTTATCATGCTTCACTCGTGGGCCAGACAAGTCCCAAACACAAAGGAAAGATTTCTCGAATGCTGGCAGCCAAAACCGTTTTGGCTATCCGTTATGATGCTTTTGGTGAGGATTCAAGTTCTGCAATGGGAGTTGAGAACAGAGCCAAATTAGAGGCCAGGTTGAGAACTTTGGAAGACAGAGGGATAAGAAAAATAAGTGGAACAGGAAAAGCATTAGCAAAAACAGAAAAATATGAACACAAAAGGTGAGTACATTTAAGTGAGGATGGGGTGAATAGTTTTTTTAAATGTTAATTATTGACAGTAATTTTTTATTGTAAACTTCACCTTGATGTGCCCATAGTTTTTTCAAATTTATTTATTTGACCAAAATTGTGTATGTTTATTGTGTGTATGTTGTTTTGGAAAATGTGCACATTGAGGAATGATTAAGTCAAGCTCATTAACATGCATTGTCTTATGTACTTTTTTTGTGGTGAGGACACCTTAAAATCTACTTAGCAATTTTCAAGAATATAATACATTGTTAGCTGTAGTTAACCATGTTGTGCACCCCTAATTTTTTTCCATGCCATTTAGTTTTCCGCATTAACTTCTACTAGTTTTCATTCATATACATATTTAATTTATTCATTTCCAGATATTGATAGTAAATTTTTTTAATCTAAAGTTCCTCTATAATATGTTCTTTATCAAAAAGTTCACTCAGCCGGGCACAGTGGC