Transcript asmbl_73183

Sequence
Transcript Sequence for observation asmbl_73183 of TGE0058231:
TGAGCAGCCTGCCACCTCCTCGGCCTCTCCCCTCCCGCCGTTGCCGTACCAGCCCACACCTTCGTCTCTGCATCTGTTCGTCCATTCCCATCACAGTTGCTGAGCGTCGGCCGCCACTCCCAGGGCCAGCAGGGCCCTGCCACTGTCAGGGTGTAGGTGTGCGGCACCAAGACCCCAGCCTGGGCCACTTCACACGCACAGGCAGGGGGCCGGAGGTCCCAAGTCCTGCCTTCTGGGGTGGCATCCTCACCACCCCCAGGGCAGATGAAGTCTCAGCACACCCAGGCTTTGCGACCCGGTCTGTGAACCTGGACACAGACACCCCGCACAGTGCTTTTAGAATTCAGATTTGGTCCGGCAGCCTCATCAGAGGGGCCCTGAGCGCCAGAGTTTGCTGCCATCCCCAGCCCACCCCTGCCGGGCTGACGGACTGAGAAGTGTGCAGCCTCAGCTCTGCACCTGGCGCCCCCAGGACAGGATACAGTCCCCTCTGTCCCACTCCAAATCCCAAAGGCAAGGAGAACCCCCCCCCCGACCCTCCACCAGTCCTGGGACTTGTCCTCAGTTCTGTAGCATCCAGCTGCCACCCCTGCTGTGGGCAGAGAGGTCGGGGAGGCCTCTGCCTTCCTTTGAGCTTCCGAGGTTGGGGAAAGGATGAAAGGGGCCCGTGCCGCCCCCGACCCCACGTGTCCCTGGCCATCTCCTTGTCCATGTTGCCTCTAACTCTGTGTTTCCCTCCCCTACGTGTCCCTTCCCCCTGCCCTCTGCATGTGACCCCGATCCCTCATCCTGGTCTCCACGCCGCCCCTCCCGCACACCTGCCTTCGGATGGCCCCGGCAGGATCATGGCGGGGCGCTGGGGCCCGAGGAGTTCAAGGCCTGCCTCATCAGCCTGGGCTACGACGTGGAGAACGACCGGCAGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGG