Transcript asmbl_70912

Sequence
Transcript Sequence for observation asmbl_70912 of TGE0001028:
TGCACGTCTTGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGCAGCTTTCAGTCATGGCCTCCGGTAACGCGCGCATCGGAAAGCCAGCCCCTGACTTCAAGGCCACAGCGGTGGTTGATGGCGCCTTCAAAGAGGTGAAGCTGTCGGACTACAAAGGGAAGTACGTGGTCCTCTTTTTCTACCCTCTGGACTTCACTTTTGTGTGCCCCACCGAGATCATCGCGTTCAGCAACCGTGCAGAGGACTTCCGCAAGCTGGGCTGTGAAGTGCTGGGCGTCTCGGTGGACTCTCAGTTCACCCACCTGGCTTGGATCAACACCCCCCGGAAAGAGGGAGGCTTGGGCCCCCTGAACATCCCCCTGCTTGCTGACGTGACCAGACGCTTGTCTGAGGATTACGGCGTGCTGAAAACAGATGAGGGCATTGCCTACAGGGGCCTCTTTATCATCGATGGCAAGGGTGTCCTTCGCCAGATCACTGTTAATGATTTGCCTGTGGGACGCTCCGTGGATGAGGCTCTGCGGCTGGTCCAGGCCTTCCAGTACACAGACGAGCATGGGGAAGTTTGTCCCGCTGGCTGGAAGCCTGGCAGTGACACGATTAAGCCCAACGTGGATGACAGCAAGGAATATTTCTCCAAACACAATTAGGCTGGCTAACGGATAGTGAGCTTGTGCCCCTGCCTAGGTGCCTGTGCTGGGTGTCCACCTGTGCCCCCACCTGGGTGCCCTATGCTGACCCAGGAAAGGCCAGACCTGCCCCTCCAAACTCCACAGTATGGGACCCTGGAGGGCTAGGCCAAGGCCTTCTCATGCCTCCACCTAGAAGCTGAATAGTGACGCCCTCCCCCAAGCCCACCCAGCCGCACACAGGCCTAGAGGTAACCAATAAAGTATTAGGGAAAGGTGTGAGTCTGTGTTGGTGTGCTCTGTCCTTTCGTCCTCCCCTGCAACCCCCTTCCTTCTTCAGGCTCAGGCTTGGGAAACTGACCCTGTGGTTGCTCATCTTCGCCACACGGTGGCGGTCTTATCACATGCTTAGTGCCTGCTCTTTTCCTGCTTGCGCTCAAGGCGGTTTCGGAGGGGTAGGGTATGCCGTTTGTCCCTTGCAAATCCCAGGATGCCCTACATCCAGAAATCTGGCCATGCAAGGCAAAGCCCACATTTTGTCACCAGCCAGCCTGGG