Transcript asmbl_69657

Sequence
Transcript Sequence for observation asmbl_69657 of TGE0006294:
GAGCTACCAAAGGAGCGGGGGACGAGGGCCGGGCTGCGGACGACCGCCGCAGCGCAGGCCGCGATATCGCAGCGGATCGGAGCAGGCCGGAGGGGCAATTAAGACCCCGGCCGTGTGCGTCCGGCCTCAGCAGCCCCGCCGCTCGGCGGACACGCAGACCCCGCCGGCCCGGGCGCGAACACTCAGCGCACCCCCGTTCCACTTGGTCCCGCCGCGCCTTCCGGTGCGCCTTCCGGTGCGCCTTCCGGTGCGCCTTCCGCTCCGCCCCTTCAGGCAGGAAGTGTCGGCGCCGCCACTGTCCGGCCACAGCCTAACGCTCTTCGCTGTCGTTTGTGGTCTCGCGCAGGGCGGCCCCGGTTCTGGTGTTTGGCGTCGGAATTAAACAACCACCATGTCGAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCCATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGCTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCCACTGATGCATACCTTGATGCCATGATGAATGAGGCCCCAGGGCCCATCAATTTCACCATGTTCCTGACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAACGCCTTTGCTTGCTTTGATGAAGAAGCAACAGGCACCATTCAGGAAGATTACCTAAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAAGAACTTTAGCTAAAATCTTCCAGTTACATTGTCTTACTCTCTTTTACTTCTCAGACACTTCCCCCACCCTCATAGAACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTCTTTTTGATGTATTTATTCCAGACCTTTCTGCCACTTAGCACTTGTATAATCAGACTGGAAATGGGGATGAGGGTGTAAATTGTATTGAAAAAGATCGCGAATAAAAATCAACAAATGTGAAAGCCCAGAAAAATATATTCGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGTTATTTTGAAATAAAGATTATGCTGACTCAAATGCAATGTAATGGCAAGTTAAACAAATGATTGATAGGTGGGGGTAGTCCTTT