Transcript asmbl_66462

Sequence
Transcript Sequence for observation asmbl_66462 of TGE0061081:
GGCCGCTGTCCCGGTGCGCACGGACGTGGCTCGAGTTTCCTCTGCTCTCCGCTCTCGCCCGCTAGCTCTCCTCCCTTCCGCTCCTGCTTCTCTCCGGGTCTCCCGCTCCAGCTCCAGCCCCACCCGGCCGGTCCCGCACGGCTCCGGGTAGCCATGGAGGACCCCACGCTCTATATTGTCGAGCGGCCGCTTCCCGGGTACCCCGACGCCGAGGCCCCGGAGCCTTCCTCCGCTGGGGCTCAGGCAGCGGAGGAGCCGTCGGGGGCCGGCTCAGAAGAGCTGATCAAGTCGGACCAGGTGAACGGCGTGCTGGTGCTGAGCCTCCTGGACAAAATCATCGGGGCCGTAGACCAGATCCAGCTGACTCAAGCACAGCTGGAGGAGCGGCAGGCGGAGATGGAGGGCGCAGTGCAGAGCATCCAGGGCGAGCTGAGCAAGCTGGGCAAGGCGCACGCCACCACGAGCAATACGGTGAGCAAGCTGCTGGAGAAGGTGCGCAAGGTCAGCGTCAACGTGAAGACCGTGCGCGGCAGCCTGGAGCGCCAGGCGGGGCAGATCAAGAAGCTGGAGGTCAACGAGGCCGAGCTGCTGCGGCGCCGCAACTTTAAAGTCATGATCTACCAGGATGAAGTGAAGCTGCCGGCCAAACTGAGCATCAGCAAATCGCTGAAAGAGTCGGAGGCGCTGCCAGAGAAGGAGGGCGAGGAGCTGGGCGAGGGCGAGCGGCCCGAGGAGGACGCAGCGGCGCTGGAGCTTTCGTCGGACGAGGCGGTGGAGGTTGAGGAGGTTATTGAGGAGTCCCGCGCAGAGCGTATCAAGCGCAGCGGCCTGCGGCGCGTGGACGACTTCAAGAAGGCCTTCTCCAAGGAGAAGATGGAGAAGACCAAGGTGCGTACCCGCGAGAACCTGGAGAAGACGCGCCTCAAGACCAAGGAAAACCTGGAGAAGACGCGGCACACCCTGGAGAAGCGCATGAACAAGCTGGGCACGCGCCTGGTGCCCGCCGAGCGGCGCGAGAAACTGAAGACGTCGCGGGACAAGTTGCGCAAATCCTTCACGCCCGACCACGTGGTGTACGCGCGCTCCAAGACCGCGGTCTACAAGGTGCCACCCTTCACCTTCCACGTCAAGAAGATCCGCGAGGGCCAGGTGGAAGTGCTCAAGGCCACCGAGATGGTGGAGGTGGGCGCCGACGACGACGAGGGCGGCGCGGAGCGCGGGGAGGCCGGCGACCTGCGGCGCGGGAGCAGCCCCGACGTGCACGCGCTGCTGGAGATCACCGAGGAGTCGGACGCCGTGCTGGTGGACAAGAGCGACAGCGACTGAGCCGCCCCCGCTGCCACCCACCCCATTCCTCGCTCCTTCCGAACTTCCTCTTTCGCATTCTCTCTCGGCTCGAGCTGGCTGAGATTTTTCTAAATTGAAAACACGCCCCCCTCCCCACACCTCCAGGAACTCCACTCCCAGTCTTAGAGCTGTTAGGACCCGATGGGGAGGCAGCCCCCGCAGTGGACAACCCCCGCTTGGACACAGTCCGAGTGGAATGGGAAGGGAATGGTCAATCCCTGTCCTGGTTGTCCAAGTCGGGATCTCAGAGGAAATTGCAGTGATTCCACGGTTAGGCCCCCCTGGGGGGGCTGCCTTCCCCTCAGCCTCTCCCCACACCACCCACCCAGCTGCTGTCATTCCGCTCACTGAGCTCTTCTTCATTCTCACCCTGATCCCTGGGGGACTCAAAGCCAAAACTGCCCAAAGAGGAAAGATTGAATCCTAAAGGGGATCCCTGCCCCCATGGGAGGCCCCCTACTAGAAGGACGTGAAAGCAGCTTTTGGGGGAAACTGAGGCAGTGGGGAAGACAGAGCAGAATGAGCCCTCACCCTGGCTGGGGGTCCAGCACAGGCTGTATCTGCAGAGGGTCCCAGAGGAACGCTGGAGCCAAGAGAAGCCCTGGGAAGGAGGGGTGGGGAACGACATGCATGTGAGGGATGGCACACTGATGTGTTTATGCACCTGTACACAGGAGCGCATGGCCATGGCTTTGGAAAGGAGAATGGAAAAATAGAAGAAGGTCGGCCGGGCTTGGTGGCTTATGCCTGTAACCCCAGCACTTTGGGA