Transcript asmbl_66027

Sequence
Transcript Sequence for observation asmbl_66027 of TGE0006885:
GTAAGGATTCGGCGGGCAAGCGGGTGTAATCAGCAGCCATCCGTTCTTGGGCATGGTGGCTTCCGACCGCGGGGACCCCGAGAGTCTCTTGTCGGCCGAGTAGCAGCCAGGAAGGAGAGACTGGGATGGTTTTTTATCTGTTGCTTTCTTAAATCAAGGGCCGCCGGGCCGGAGATGGATGGAGGGACCGGGGATTTGGGAACTCGAAAACGAGCTGAGGGAAGGGAGCCTGTGGAAATAGACTGGAGTCTGGGTAGTGTCGTTTCCTAGAGAATGGTCTCGAAGTAACTTCTCGGTAAAGTCTTCACGGAATTTCCAGACCACACTTGCCCACTGGGAGGCTTTTAGGACCCGAGACGTGTGCAGGCTTTTCCAGCCAAAATGAAGTTTAATCCCTTTGTGACTTCCGACCGAAGCAAGAATCGCAAAAGGCATTTCAATGCACCTTCCCACATTCGAAGGAAGATTATGTCTTCCCCTCTTTCCAAAGAGCTGAGACAGAAGTACAACGTGCGATCCATGCCCATCCGAAAGGATGATGAAGTTCAGGTTGTACGTGGACACTATAAAGGTCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATATGTTATCTACATTGAACGGGTGCAGCGGGAAAAGGCTAATGGCACAACTGTCCACGTAGGCATTCACCCCAGCAAGGTGGTTATCACTAGGCTAAAACTGGACAAAGACCGCAAAAAGATCCTCGAACGGAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATACAAGGAAGAAACCATTGAGAAGATGCAGGAATAAAGTAATCTTATATACAAGCTTTGATTAAAACTTG