Transcript asmbl_32904

Sequence
Transcript Sequence for observation asmbl_32904 of TGE0004902:
CGCGCTAGGCCAGTGCCATGGCGGTAGTGGCGGCCCTTCTGCGCGGCTGTGTCCGCCGGTGCAGCCCCCTGCTTCGGCTACAGATGCAGGAAATAAGTTATGTAAAACGAAGTTATGTATCAAAACCCACTTTGAATGAAGTGGTAATAGTAAGTGCTATAAGAACACCCATTGGATCCTTTCTAGGCAGCCTTTCCTCCCTGCCAACCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAGGCGCCTACTAGGCAAGCAGTACTAGGTGCAGGCTTACCAGTATCTATTCCATGTACCACTATAAACAAAGTGTGTGCCTCAGGAATGAAAGCCATTATGATGGCTTCTCAGAATCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAACACTCCCTATGTAATGAACAGAGGAGCAACACCGTATGGTGGGGTAAAGCTTGAAGATTCAATAGTAAAAGATGGGCTAACCGACGTCTACAATAAAATTCATATGGGCAACTGTGCTGAGAATACGGCAAAGAAGCTGAATATTGCACGAGATGAACAGGATACTTATGCTATTAACTCCTACACCAGAAGTAAATCAGCATGGGAAGCTGGAAAATTTGGAAATGAAGTTATTCCTGTCACAATTACAGTAAGAGGCAAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTCACTAAAGTTCCAAAACTGAAGACAGTATTCCAAAAAGAAAACGGTACAGTAACAGCTGCCAATGCCAGCACACTGAATGATGGAGCAGCTGCTATGGTTCTGATGACTGCAGATGCAGCCAAGCGACTCAACGTTAAACCACTGGCAAGAATAGCAGCATTTGCTGATGCTGCTGTAGACCCTATTGATTTTCCAATTGCACCTGCATATGCTGTACCTAAGGTTCTTAAAGATGCAGGATTGAAAAAAGAAGATATTACAATGTGGGAAGTAAATGAAGCCTTTAGTCTCGTTGTACTAGCAAACATTAAAATGCTGGAGATTGATCCTCAAAAAGTGAATATCCATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTCATTCATTTGGTTCATGCTTTGAAGCAAGGAGAATATGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTGATCCAGAAGCTGTAAGACAACAACCTCTGTTGTCTAAGGAGACAATCCTATGTGGCTAGAAAGGCCTGCTGTAATCAGTGTGACTACCTTGGGTCAGCTTGTTCTCAAAATAACATTACGTTTTTAAATTATTTTCTATTTTAACTTTTTTTATAAGGGGA