Transcript asmbl_57565

Sequence
Transcript Sequence for observation asmbl_57565 of TGE0005013:
CAAAACACGTGAGTCCTGTTGGTCGCTGCAGCGGGCCTCTGCGTGGGCGGCGGGAATCCGCGGACATCGGGTCGGGTCTAGGCTCCCGAGTCCGCGCTCCTGGGCGGGAGCCCTTGTCTGGGTCTCGCGGGGGGCTGCCAGATGCGTAGGCCACACTGACTAGTTCCTTCTTGTCGCTTTTCCCAGCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGGGGCCCTGGTGGCCCTGGGATGGGGAACCGCGGTGGCTTCCGCGGAGGTTTCGGCAGTGGCATCCGGGGCCGGGGTCGCGGCCGTGGACGGGGCCGGGGCCGAGGCCGCGGAGCTCGCGGAGGCAAGGCCGAGGATAAGGAGTGGATGCCCGTCACCAAGTTGGGCCGCTTGGTCAAGGACATGAAGATCAAGTCCCTGGAGGAGATCTATCTCTTCTCCCTGCCTATTAAGGAATCAGAGATCATTGATTTCTTCCTGGGGGCCTCTCTCAAGGATGAGGTTTTGAAGATTATGCCAGTGCAGAAGCAGACCCGTGCCGGCCAGCGCACCAGGTTCAAGGCATTTGTTGCTATCGGGGACTACAATGGCCACGTCGGTCTGGGTGTTAAGTGCTCCAAGGAGGTGGCCACCGCCATCCGTGGGGCCATCATCCTGGCCAAGCTCTCCATCGTCCCCGTGCGCAGAGGCTACTGGGGGAACAAGATCGGCAAGCCCCACACTGTCCCTTGCAAGGTAGGCTGGTGGCAGGTGATGGGCCTGCCGTGGGGCAGGCTCCCTCGGGCCCCCGTCTCCTGACTCCTTCCCTCACCAGGTGACAGGCCGCTGCGGCTCTGTGCTGGTACGCCTCATCCCTGCACCCAGGGGCACTGGCATCGTCTCCGCACCTGTGCCTAAGAAGCTGCTCATGATGGCTGGTATCGATGACTGCTACACCTCAGCCCGGGGCTGCACTGCCACCCTGGGCAACTTCGCCAAGGCCACCTTTGATGCCATTTCTAAGACCTACAGCTACCTGACCCCCGACCTCTGGAAGGAGACTGTATTCACCAAGTCTCCCTATCAGGAGTTCACTGACCACCTCGTCAAGACCCACACCAGAGTCTCCGTGCAGCGGACTCAGGCTCCAGCTGTGGCTACAACATAGGGTTTTTATACAAGAAAAATAAAGTGAATTAAGCGTG