Transcript asmbl_53619

Sequence
Transcript Sequence for observation asmbl_53619 of TGE0000626:
CCCTAGGGAGCGGGTCCTAGGAGCCTGCTGGAGGGCGACCGCTGGGCCAGCTTCCTCTCTGCTGACTGAGGGGAGGCCAGGCTGCCTGCAAGGGGAAGGGGCCCTTTCCGCGCTTACCAGGAATGTTGGCTACCAGGGTATTTAGCCTAGTTGGCAAGCGAGCAATTTCCACCTCTGTGTGTGTACGAGCTCATGAAAGTGTTGTGAAGAGCGAAGACTTTTCGCTCCCAGCTTATATGGATCGGCGTGACCACCCCTTGCCGGAGGTGGCCCATGTCAAGCACCTGTCTGCCAGCCAGAAGGCATTGAAGGAGAAGGAGAAGGCCTCCTGGAGCAGCCTCTCCATGGATGAGAAAGTCGAGTTGTATCGCATTAAGTTCAAGGAGAGCTTTGCTGAGATGAACAGGGGCTCGAACGAGTGGAAGACGGTTGTGGGCGGTGCCATGTTCTTCATCGGTTTCACCGCGCTCGTTATCATGTGGCAGAAGCACTATGTGTACGGCCCCCTCCCGCAAAGCTTTGACAAAGAGTGGGTGGCCAAGCAGACCAAGAGGATGCTGGACATGAAGGTGAACCCCATCCAGGGCTTAGCCTCCAAGTGGGACTACGAAAAGAACGAGTGGAAGAAGTGAGAGATGCTGGCCTGCGCCTGCACCTGCGCCTGGCTCTGTCACCGCCATGCAACTCCATGCCTATTTACTGGAAACCTGTTATGCCAAACAGTTGTACCACTGCTAATAAATGACCAG