Transcript asmbl_46727

Sequence
Transcript Sequence for observation asmbl_46727 of TGE0000435:
CTCACGCCCCGTCCCCTCCTCTTGACGTGGCAGAGGCGGCGCCAGCCATGTTGGCCGGGCGGAGGTCTTCGCTGAGGCCCGGGGCGGGGTGGCGCCACCCCTGATTGCGGTGCCACGGACTGCTCCTGCTGGGCGGAGAGGACAGATTTTGCAAAGCGGAGGCTGCGACGGGTCCTGCAGGGGGACAGTGAGGAAAGGGCCGCCTCGTCTCCGCTCCTGGGGGACCGCAGAAATAAGAATCAAACTCCACAATGACAACCTATTTGGAATTCATTCAACAAAATGAAGAACGAGATGGAGTCCGATTTAGTTGGAATGTTTGGCCATCAAGTCGACTGGAAGCTACAAGAATGGTTGTTCCTGTGGCAGCCCTGTTTACACCACTGAAAGAGAGACCTGACTTACCACCTATTCAATATGAACCTGTTCTGTGTAGTAGGACCACTTGCCGTGCAGTTTTGAATCCTTTATGTCAAGTGGATTATCGAGCAAAACTTTGGGCTTGCAACTTTTGTTACCAAAGGAATCAGTTTCCACCTAGTTATGCTGGTATATCTGAACTGAATCAGCCTGCTGAACTTTTACCTCAGTTTTCTAGCATTGAATATGTAGTTCTGCGTGGTCCTCAGATGCCTTTGATATTCCTCTATGTGGTTGATACTTGCATGGAAGATGAAGATTTACAAGCCCTGAAAGAATCCATGCAGATGTCATTAAGTCTTTTACCACCTACAGCTTTGGTTGGACTTATTACTTTTGGGAGAATGGTTCAGGTTCATGAACTTGGATGTGAAGGCATTTCAAAAAGCTATGTCTTCAGAGGAACAAAAGATTTGTCTGCCAAACAACTGCAGGAAATGCTGGGGCTCTCTAAAGTACCACTTACTCAAGCAACACGTGGTCCTCAGGTACAGCAGCCACCTCCTTCCAACAGATTCTTACAACCAGTACAGAAAATAGACATGAATCTCACAGATCTTCTGGGAGAACTCCAGCGAGACCCTTGGCCTGTACCACAGGGAAAGAGACCTTTGCGTTCCTCTGGGGTGGCACTTTCCATAGCTGTAGGACTGCTGGAGTGTACTTTTCCCAACACTGGTGCTCGTATCATGATGTTCATTGGTGGTCCTGCTACTCAGGGGCCTGGAATGGTGGTTGGAGATGAGTTGAAGACACCTATAAGATCGTGGCATGACATTGACAAAGACAATGCCAAATATGTTAAAAAGGGAACTAAGCATTTTGAAGCATTGGCTAATCGAGCTGCTACAACTGGCCATGTTATTGATATCTATGCGTGTGCATTAGATCAGACAGGTCTCCTGGAGATGAAATGCTGTCCCAACCTTACTGGAGGATACATGGTAATGGGTGATTCTTTCAATACTTCCTTATTCAAACAAACTTTTCAAAGAGTCTTTACCAAAGACATGCATGGACAGTTTAAAATGGGCTTTGGTGGTACGCTAGAAATAAAGACCTCAAGGGAAATAAAGATTTCAGGAGCTATTGGACCCTGTGTGTCACTCAATTCTAAAGGACCCTGTGTGTCTGAAAATGAGATAGGAACAGGTGGCACATGTCAGTGGAAGATATGTGGACTTAGTCCCACTACAACCTTAGCCATATATTTTGAGGTTGTCAATCAGCATAATGCTCCAATTCCTCAAGGAGGGCGTGGTGCAATCCAGTTTGTGACTCAGTATCAGCATTCAAGTGGGCAGAGACGCATCCGAGTGACCACCATTGCTAGGAACTGGGCAGATGCTCAAACTCAAATCCAAAACATTGCTGCATCTTTTGACCAGGAGGCAGCTGCCATTCTTATGGCCCGGCTAGCAATATATAGAGCAGAAACAGAAGAAGGTCCAGATGTGCTTAGGTGGCTGGACAGACAGCTCATTCGACTGTGTCAGAAATTTGGAGAATATCATAAAGATGACCCAAGTTCCTTCAGATTTTCAGAAACTTTCTCCCTTTATCCACAGTTTATGTTTCATTTAAGAAGATCTTCTTTCCTGCAAGTTTTTAACAATAGTCCTGATGAGAGTTCATATTATCGTCACCATTTTATGCGTCAAGATCTGACCCAGTCTCTAATTATGATTCAGCCTATCCTGTATGCGTATTCTTTTAGTGGACCACCAGAGCCGGTTCTTCTTGATAGCAGTAGCATTCTTGCAGATCGTATTCTTCTCATGGACACATTCTTCCAGATTTTGATTTATCATGGTGAGACCATAGCACAGTGGCGGAAGTCAGGATACCAGGATATGCCTGAGTATGAAAATTTCCGCCACCTTCTGCAAGCCCCAGTGGATGATGCACAGGAAATTCTTCACTCCAGATTTCCAATGCCAAGATACATTGACACTGAACATGGAGGCAGCCAGGCCCGTTTCCTCCTTTCAAAAGTCAACCCTTCACAGACTCATAATAATATGTATGCCTGGGGGCAGGAGTCTGGAGCACCTATTCTTACAGATGATGTTAGTTTACAAGTGTTTATGGATCACTTGAAGAAACTTGCTGTGTCCAGTGCTGCTTGAAGTGCTAATAATGTTAAAGACACTTAAGAAGATGAAATAATATTCAAATTTCATTTTTTCCTTTTTCCATTTATCTGTGGAAACCAACAGATATTGCTCTATATTTTTTGTATTAGTATGGTTTGAGACAACATATGGAAAATGTTCACATTTGTAGATTAAGCTGGAATTATAATGAGAGCAATAAGAACAAATTTATTTTGCTTACCACAGTGTTATAGCTGGTTCTAGAAATTTGAAGTCTTTATAACTTAATTATGTTTAATAAAAAATAGAGTCTGCCTCGTACTACAGATGTAACTCATTTGTATATTGCAGACAGACCCAAAGTGGCACTGAATTTTCTTGCTCACCTTTTAAAAACTTGTTCCTTAATTTTAGCCAGAAAGCAAAAAAACAATAGTAATGATAAATGTGAACATTTTTGCTTATTCATTGAATATTTTTCTGTAATTTTCAGCACTTATGTATACACTTTTTCTGTACTTACTAGGTTAAGGCAGATTTATTTTTATGATTTGTTTAGGAATTATTTGATTTTATAATGGTAATTTTCATGATGATAATGTTTTTGGTTATTTGGAAAGATAGTTTAGAGATGAAAGGTTTTTTTGGGTAACAATCCCGCAGCTGACAAAAAATGTGAAATTTCCACAAAATATCCAACTTATGTGACTAAACGCAGTAGTTTTTTTAAAAGGGGAGATAGAAAATAAATGGTTTTGTTGGAGTGCATTTTAGTAAGCCTTTGCAGTAAAATGACGGTTGTAACTACTAAACCAAATTTAGTTTTCACAGCATGGTTTTGTTGTTTTCCCCTTGTTTTTCAGAGGTAAATTTTGCATTATATCCTTCAGTATTTTAACACTATTTTGGCAGTTTACACATTACTTTTTGTTTTTCCTTCCTTTTTGTGAAATGTATTAAGTTGTGGTTCTTATTGAAACAGTATTATATAATGTTTGCTTAATTATATCATGTGATGCTCAGTTCTATTTTGATTTATTCATTAGTATTCACTTTTACCTTTAAAGTTTACTTGTAGCAAATATGTTTACATTGATAAAGCCAGATATGTTTTGACAATGAAATTTACATATCAAGTACTGCAAATAAAAGGTGGTGCTATGATATATGCTTAGGAGGACAGTTTTAATGATTGTACTTGCATGAACACAATCATATGATGGTAAAGCAGAAACTTAAGAAAAAATTGTTTATGTGTTATATTCAATTAGCTTAAATAAGTTGCTTTGTTATATTTTATTTGAATTGAACTACGCTAGGCCTAAATGCCAATAAAATATACTTTTCACTGTT