Transcript asmbl_46492

Sequence
Transcript Sequence for observation asmbl_46492 of TGE0061002:
CTAACGCTGTTGGGACCCGGAAGCGGAAAGGGCATCTTTGAGGTCGATACTTCCGGGTCATTGGGAGAGTGCGGGATTCCTGGGCCGAGAGCGGGTGGCTGAGCCGGGACCTCGCGTGATTCTCGGAACCCGAGGAGAAGCGGCGTCCGGGGCTATGGCTGTGACTCTGGACAAAGACGCTTATTATCGGCGAGTGAAGAGACTGTACAGCAATTGGCGGAAAGGAGAAGATGAGTATGCCAACGTTGATGCCATTGTTGTATCAGTGGGTGTTGATGAAGAAATTGTTTATGCCAAATCAACTGCCTTACAGACATGGCTCTTTGGTTATGAACTAACTGATACTATCATGGTCTTTTGTGATGACAAAATCATCTTTATGGCCAGCAAGAAAAAAGTGGAGTTCTTGAAACAGATTGCCAACACTAAGGGCAATGAGAATGCTAATGGAGCCCCTGCCATCACACTGCTAATACGAGAAAAGAATGAAAGTAATAAGAGTAGCTTTGACAAAATGATTGAAGCCATTAAAGAAAGCAAGAATGGCAAGAAGATTGGAGTGTTCAGCAAAGACAAATTCCCTGGAGAGTTCATGAAGAGCTGGAATGACTGCCTCAACAAAGAAGGCTTTGACAAAATAGATATCAGTGCAGTTGTGGCATATACCATCGCTGTAAAGGAGGATGGGGAGCTCAACCTAATGAAGAAAGCAGCCAGCATCACTTCTGAAGTCTTCAACAAATTCTTCAAGGAAAGAGTCATGGAAATAGTTGATGCAGATGAGAAAGTTCGACACAGCAAACTGGCTGAGTCTGTGGAAAAGGCCATTGAAGAGAAAAAATACCTTGCTGGGGCAGACCCTTCTACTGTGGAAATGTGTTACCCTCCTATCATTCAGAGTGGTGGCAACTATAATCTCAAGTTCAGTGTGGTGAGTGACAAGAATCATATGCACTTTGGGGCTATCACTTGTGCCATGGGTATTCGCTTCAAGTCTTACTGCTCCAACCTTGTTCGCACTTTGATGGTTGATCCTTCTCAAGAAGTTCAAGAAAATTATAACTTTTTGCTCCAGCTTCAAGAGGAGCTGCTGAAGGAATTAAGACATGGTGTGAAGATATGTGACGTGTATAACGCTGTCATGGACGTGGTTAAAAAGCAGAAGCCAGAACTGCTGAACAAAATTACCAAAAACCTAGGGTTTGGGATGGGAATTGAATTCCGTGAAGGCTCCCTAGTAATCAATAGCAAAAATCAATACAAACTGAAGAAAGGAATGGTTTTCAGCATCAATTTAGGATTCTCAGACCTGACTAACAAGGAGGGGAAAAAGCCAGAAGAGAAAACCTATGCCCTGTTCATTGGTGACACAGTGCTTGTGGATGAGGATGGCCCAGCTACTGTTCTCACTTCTGTGAAGAAGAAAGTGAAGAATGTGGGGATTTTCCTAAAGAATGAAGATGAGGAAGAAGAGGAGGAGGAGAAAGATGAGGCAGAGGACCTTTTGGGAAGAGGTTCTCGGGCAGCATTACTTACAGAAAGAACAAGAAATGAAATGACTGCAGAAGAGAAGCGAAGAGCACATCAGAAAGAACTAGCGGCTCAACTCAATGAAGAAGCAAAGAGGCGATTGACTGAACAAAAGGGAGAACAGCAGATTCAGAAAGCTCGCAAGTCTAATGTGTCCTATAAAAACCCATCTCTGATGCCTAAGGAACCACATATTCGGGAAATGAAGATCTACATCGATAAGAAATATGAGACTGTAATAATGCCCGTGTTTGGCATTGCAACACCGTTTCACATTGCCACAATCAAGAATATAAGTATGTCCGTGGAAGGAGATTATACTTACTTGCGAATCAACTTTTATTGCCCAGGCAGTGCTCTGGGCAGGAATGAAGGCAACATCTTTCCTAACCCTGAAGCGACTTTTGTCAAGGAAATTACATACCGAGCATCAAATATTAAGGCACCCGGAGAACAGACAGTACCAGCCTTGAACCTTCAGAATGCTTTCCGAATTATTAAAGAAGTACAGAAACGTTATAAAACTCGAGAAGCTGAAGAGAAAGAGAAGGAGGGGATTGTAAAACAAGACTCACTGGTGATCAATCTAAACCGGAGTAATCCGAAACTGAAAGATCTATACATTCGCCCAAATATTGCCCAAAAGAGGATGCAAGGCTCACTGGAGGCCCATGTCAATGGCTTCCGCTTCACATCTGTTCGAGGAGACAAAGTGGATATTTTGTACAATAATATTAAGCATGCTTTGTTCCAGCCCTGTGATGGAGAAATGATTATTGTCTTGCACTTTCACCTCAAGAATGCCATCATGTTTGGGAAGAAGCGGCACACGGATGTGCAGTTCTACACAGAAGTGGGAGAGATAACCACGGACTTGGGGAAACATCAGCATATGCATGACCGAGATGACCTCTATGCTGAGCAGATGGAACGAGAAATGAGGCACAAACTGAAAACAGCCTTTAAAAATTTCATTGAGAAAGTAGAGGCTCTAACTAAGGAGGAACTGGAATTTGAAGTGCCTTTTAGGGACTTGGGATTTAACGGAGCTCCCTATAGGAGTACCTGCCTCCTTCAGCCCACTAGTAGTGCGCTGGTAAATGCTACGGAATGGCCACCTTTTGTGGTGACATTGGATGAGGTAGAGCTGATCCACTTTGAGCGGGTCCAGTTTCACCTGAAGAACTTTGATATGGTAATCGTCTACAAGGACTACAGCAAGAAAGTGACCATGATCAACGCCATTCCTGTAGCCTCTCTTGACCCCATCAAGGAATGGTTGAATTCCTGCGACCTGAAATACACAGAAGGAGTACAGTCCCTCAACTGGACTAAAATCATGAAGACCATTGTTGATGACCCTGAGGGCTTCTTCGAACAAGGTGGCTGGTCTTTCCTGGAGCCTGAGGGTGAGGGGAGTGATGCTGAAGAAGGGGATTCAGAGTCTGAAATTGAAGATGAGACTTTTAATCCTTCAGAAGATGACTATGAAGAGGAAGAGGAGGACAGTGATGAAGATTATTCATCAGAAGCAGAAGAGTCAGACTATTCTAAGGAGTCATTGGGTAGTGAAGAAGAGAGTGGAAAGGATTGGGATGAACTGGAGGAAGAAGCCCGAAAAGCGGACCGAGAAAGTCGTTACGAGGAAGAAGAAGAACAAAGTCGAAGTATGAGCCGGAAGAGGAAGGCATCTGTGCACAGTTCGGGCCGTGGCTCTAACCGTGGTTCCAGACACAGCTCTGCACCCCCCAAGAAAAAGAGGAAGTAACTTCTGAACTTTGGCCCTGAGCTCCATTCTTCCTCCAGCCAACCCCTGAAAATTTTACATGACATAGAAACTGTATTTTTCCTTTCGTTTTCATTTGAAGTTTTGCCATTTGTGTTTATGGGTTTAGGGGGCCATTTGTGTGGACCAATCTACTCGGGGAATTCCAGGCCCACCAGGACACGTGCCAATGGCCCCATTCAGATGGCAAGGGAGGAGGTGTTCTTGAAGACAGGAGGAGGCTCCCGCTGTTAATAAATATTGTTTCATTCTTCTCTCTTCCTGTCACCTTCTGCCAAGACATTGATGGCTTCTGACATCTTATTTGGTGTCTCAAAGCTGTATTTCCAAGACAGTGGTACAAGGTGACCCTTAATTACCCGTATCATGGTTCTTGACCAGCACATTCAATCCTCCAACCTACCCTACTGCCATGACCTTCCGCACATCTCTAAGTTTTATCTTTGCAATACTCAAGGTTCTCGGAAATTTGCTAATGGTTGTGATAAACCATACAGCTTGAGCCAGTGAGGCAGATTGGGCTGGTGCCTTCGTCTGAGTTTTCCTGCTTTCCTGCCTCGTGCAGATTCTGAGGTATATCTGCTGCCTTGGAAGACATAAGAAGCAGTGATACTCCCTGGCTCGGTTATTTTCTCCATACAATGCACACATGGTACAATGATAGAAGGCAAAATTGCCACTGTCTTCTTTTTTTTCTCATATATCTAAGGAAGATATATCAGGTTGTGCCTCATGTACCGCTTCTAGTGAAATGTAGAGGAAGGCTCAAAGGAGTCAACATTTATATCTGGAAGGGACAAGTCATGCCTTGGGCCTAGAATACCCTGATGAGAAAAGAGAAGAGGAAGGGAGGCCATATCTACAACACAGCCTCTCGGCACTGCTGCTCCTTATTTTAACTTTGTCTTGCATTGTCCTGTATTTATCACAGTTTCTGTTGAACAGCTTTTCAAGTATTTGGGGAGTTTATCTTGCCATCCTCCCCTTCTGGTTCTCTGCACCCACCTGTCCCACTGCAGTTCCTTCCGTGCTCTGTGACTTTAAGAGAAGAAGGGGGGAGGGGTCCCGGATTTTATGTTTGTTTGTTTTTTCTCCTTAGCAGTAGGACTTGATATTTTCAATTTTGGAAGAACTAAAAGATGAATAAACTGGGTTTTTTTTGTTGTTTGTTTTTGTAAATTCACCTGTGACCGTTCATTTTCAGTTCTTGAAAGCAAGCCTGCTTCCTGCCTGGTAAAGTGCTAAGGTACTGG