Transcript asmbl_46491

Sequence
Transcript Sequence for observation asmbl_46491 of TGE0061001:
CTAACGCTGTTGGGACCCGGAAGCGGAAAGGGCATCTTTGAGGTCGATACTTCCGGGTCATTGGGAGAGTGCGGGATTCCTGGGCCGAGAGCGGGTGGCTGAGCCGGGACCTCGCGTGATTCTCGGAACCCGAGGAGAAGCGGCGTCCGGGGCTATGGCTGTGACTCTGGACAAAGACGCTTATTATCGGCGAGTGAAGAGACTGTACAGCAATTGGCGGAAAGGAGAAGATGAGTATGCCAACGTTGATGCCATTGTTGTATCAGTGGGTGTTGATGAAGAAATTGTTTATGCCAAATCAACTGCCTTACAGACATGGCTCTTTGGTTATGAACTAACTGATACTATCATGGTCTTTTGTGATGACAAAATCATCTTTATGGCCAGCAAGAAAAAAGTGGAGTTCTTGAAACAGATTGCCAACACTAAGGGCAATGAGAATGCTAATGGAGCCCCTGCCATCACACTGCTAATACGAGAAAAGAATGAAAGTAATAAGAGTAGCTTTGACAAAATGATTGAAGCCATTAAAGAAAGCAAGAATGGCAAGAAGATTGGAGTGTTCAGCAAAGACAAATTCCCTGGAGAGTTCATGAAGAGCTGGAATGACTGCCTCAACAAAGAAGGCTTTGACAAAATAGATATCAGTGCAGTTGTGGCATATACCATCGCTGTAAAGGAGGATGGGGAGCTCAACCTAATGAAGAAAGCAGCCAGCATCACTTCTGAAGTCTTCAACAAATTCTTCAAGGAAAGAGTCATGGAAATAGTTGATGCAGATGAGAAAGTTCGACACAGCAAACTGGCTGAGTCTGTGGAAAAGGCCATTGAAGAGAAAAAATACCTTGCTGGGGCAGACCCTTCTACTGTGGAAATGTGTTACCCTCCTATCATTCAGAGTGGTGGCAACTATAATCTCAAGTTCAGTGTGGTGAGTGACAAGAATCATATGCACTTTGGGGCTATCACTTGTGCCATGGGTATTCGCTTCAAGTCTTACTGCTCCAACCTTGTTCGCACTTTGATGGTTGATCCTTCTCAAGAAGTTCAAGAAAATTATAACTTTTTGCTCCAGCTTCAAGAGGAGCTGCTGAAGGAATTAAGACATGGTGTGAAGATATGTGACGTGTATAACGCTGTCATGGACGTGGTTAAAAAGCAGAAGCCAGAACTGCTGAACAAAATTACCAAAAACCTAGGGTTTGGGATGGGAATTGAATTCCGTGAAGGCTCCCTAGTAATCAATAGCAAAAATCAATACAAACTGAAGAAAGGAATGGTTTTCAGCATCAATTTAGGATTCTCAGACCTGACTAACAAGGAGGGGAAAAAGCCAGAAGAGAAAACCTATGCCCTGTTCATTGGTGACACAGTGCTTGTGGATGAGGATGGCCCAGCTACTGTTCTCACTTCTGTGAAGAAGAAAGTGAAGAATGTGGGGATTTTCCTAAAGAATGAAGATGAGGAAGAAGAGGAGGAGGAGAAAGATGAGGCAGAGGACCTTTTGGGAAGAGGTTCTCGGGCAGCATTACTTACAGAAAGAACAAGAAATGAAATGACTGCAGAAGAGAAGCGAAGAGCACATCAGAAAGAACTAGCGGCTCAACTCAATGAAGAAGCAAAGAGGCGATTGACTGAACAAAAGGGAGAACAGCAGATTCAGAAAGCTCGCAAGTCTAATGTGTCCTATAAAAACCCATCTCTGATGCCTAAGGAACCACATATTCGGGAAATGAAGATCTACATCGATAAGAAATATGAGACTGTAATAATGCCCGTGTTTGGCATTGCAACACCGTTTCACATTGCCACAATCAAGAATATAAGTATGTCCGTGGAAGGAGATTATACTTACTTGCGAATCAACTTTTATTGCCCAGGCAGTGCTCTGGGCAGGAATGAAGGCAACATCTTTCCTAACCCTGAAGCGACTTTTGTCAAGGAAATTACATACCGAGCATCAAATATTAAGGCACCCGGAGAACAGACAGTACCAGCCTTGAACCTTCAGAATGCTTTCCGAATTATTAAAGAAGTACAGAAACGTTATAAAACTCGAGAAGCTGAAGAGAAAGAGAAGGAGGGGATTGTAAAACAAGACTCACTGGTGATCAATCTAAACCGGAGTAATCCGAAACTGAAAGATCTATACATTCGCCCAAATATTGCCCAAAAGAGGATGCAAGGCTCACTGGAGGCCCATGTCAATGGCTTCCGCTTCACATCTGTTCGAGGAGACAAAGTGGATATTTTGTACAATAATATTAAGCATGCTTTGTTCCAGCCCTGTGATGGAGAAATGATTATTGTCTTGCACTTTCACCTCAAGAATGCCATCATGTTTGGGAAGAAGCGGCACACGGATGTGCAGTTCTACACAGAAGTGGGAGAGATAACCACGGACTTGGGGAAACATCAGCATATGCATGACCGAGATGACCTCTATGCTGAGCAGATGGAACGAGAAATGAGGCACAAACTGAAAACAGCCTTTAAAAATTTCATTGAGAAAGTAGAGGCTCTAACTAAGGAGGAACTGGAATTTGAAGTGCCTTTTAGGGACTTGGGGTAACCTATCTTATTTTTGGCTTGAAGTTTGACTGGTCTGTCTTTTGGTACAATAAATTATTCTTCCTTTAATAATAATTTAACATATCATATCCTTTTTTCCTATGACTAATAATCTTTGAGACATCCATTTTTTCTTGAAAATGTTTAAGGGTTTAGGTGAGTGGCTAACTCTTAAGAGGCTTCCTCTGGATGAGTCTCCAGTGAGTATGCTGGAGCTGTTTGGAATGGGGAGAGGGAAGAAGTTTGTCTGTTGTGGTAGGAGCAGTCTCTCTCGTGATGAGCTCAGTCTTAAAAGTTTGTCTCTTCCAGATTTAACGGAGCTCCCTATAGGAGTACCTGCCTCCTTCAGCCCACTAGTAGTGCGCTGGTAAATGCTACGGAATGGCCACCTTTTGTGGTGACATTGGATGAGGTAGAGCTGATCCACTTTGAGCGGGTCCAGTTTCACCTGAAGAACTTTGATATGGTAATCGTCTACAAGGACTACAGCAAGAAAGTGACCATGATCAACGCCATTCCTGTAGCCTCTCTTGACCCCATCAAGGAATGGTTGAATTCCTGCGACCTGAAATACACAGAAGGAGTACAGTCCCTCAACTGGACTAAAATCATGAAGACCATTGTTGATGACCCTGAGGGCTTCTTCGAACAAGGTGGCTGGTCTTTCCTGGAGCCTGAGGGTGAGGGGAGTGATGCTGAAGAAGGGGATTCAGAGTCTGAAATTGAAGATGAGACTTTTAATCCTTCAGAAGATGACTATGAAGAGGAAGAGGAGGACAGTGATGAAGATTATTCATCAGAAGCAGAAGAGTCAGACTATTCTAAGGAGTCATTGGGTAGTGAAGAAGAGAGTGGAAAGGATTGGGATGAACTGGAGGAAGAAGCCCGAAAAGCGGACCGAGAAAGTCGTTACGAGGAAGAAGAAGAACAAAGTCGAAGTATGAGCCGGAAGAGGAAGGCATCTGTGCACAGTTCGGGCCGTGGCTCTAACCGTGGTTCCAGACACAGCTCTGCACCCCCCAAGAAAAAGAGGAAGTAACTTCTGAACTTTGGCCCTGAGCTCCATTCTTCCTCCAGCCAACCCCTGAAAATTTTACATGACATAGAAACTGTATTTTTCCTTTCGTTTTCATTTGAAGTTTTGCCATTTGTGTTTATGGGTTTAGGGGGCCATTTGTGTGGACCAATCTACTCGGGGAATTCCAGGCCCACCAGGACACGTGCCAATGGCCCCATTCAGATGGCAAGGGAGGAGGTGTTCTTGAAGACAGGAGGAGGCTCCCGCTGTTAATAAATATTGTTTCATTCTTCTCTCTTCCTGTCACCTTCTGCCAAGACATTGATGGCTTCTGACATCTTATTTGGTGTCTCAAAGCTGTATTTCCAAGACAGTGGTACAAGGTGACCCTTAATTACCCGTATCATGGTTCTTGACCAGCACATTCAATCCTCCAACCTACCCTACTGCCATGACCTTCCGCACATCTCTAAGTTTTATCTTTGCAATACTCAAGGTTCTCGGAAATTTGCTAATGGTTGTGATAAACCATACAGCTTGAGCCAGTGAGGCAGATTGGGCTGGTGCCTTCGTCTGAGTTTTCCTGCTTTCCTGCCTCGTGCAGATTCTGAGGTATATCTGCTGCCTTGGAAGACATAAGAAGCAGTGATACTCCCTGGCTCGGTTATTTTCTCCATACAATGCACACATGGTACAATGATAGAAGGCAAAATTGCCACTGTCTTCTTTTTTTTCTCATATATCTAAGGAAGATATATCAGGTTGTGCCTCATGTACCGCTTCTAGTGAAATGTAGAGGAAGGCTCAAAGGAGTCAACATTTATATCTGGAAGGGACAAGTCATGCCTTGGGCCTAGAATACCCTGATGAGAAAAGAGAAGAGGAAGGGAGGCCATATCTACAACACAGCCTCTCGGCACTGCTGCTCCTTATTTTAACTTTGTCTTGCATTGTCCTGTATTTATCACAGTTTCTGTTGAACAGCTTTTCAAGTATTTGGGGAGTTTATCTTGCCATCCTCCCCTTCTGGTTCTCTGCACCCACCTGTCCCACTGCAGTTCCTTCCGTGCTCTGTGACTTTAAGAGAAGAAGGGGGGAGGGGTCCCGGATTTTATGTTTGTTTGTTTTTTCTCCTTAGCAGTAGGACTTGATATTTTCAATTTTGGAAGAACTAAAAGATGAATAAACTGGGTTTTTTTTGTTGTTTGTTTTTGTAAATTCACCTGTGACCGTTCATTTTCAGTTCTTGAAAGCAAGCCTGCTTCCTGCCTGGTAAAGTGCTAAGGTACTGG