Transcript asmbl_46490

Sequence
Transcript Sequence for observation asmbl_46490 of TGE0000421:
TTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGTCGGCTTCTCTACGCAGAACCCGGGAGTAGGAGACTCAGAATCGAATCTCTTCTCCCTCCCCTTCTTGTGAGATTTTTTTGATCTTCAGCTACATTTTCGGCTTTGTGAGAAACCTTACCATCAAACACGATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATTGGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTATGGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAGAGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCTGCAGCGGAGATGTACGGCTCCTCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCAGCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGTGTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGGGGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTGACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAACAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGCTCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCTGCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTGGAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCCAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATCTCATTTAGTTGAGTAGCTCTTGAAAGCAGCTTTGAGTTAGAAGTATGTGTGTTACACCCTCACATTAGTGTGCTGTGTGGGGCAGTTCAACACAAATGTAACAATGTATTTTTGTGAATGAGAGTTGGCATGTCAAATGCATCCTCTAGAAAAATAATTAGTGTTATAGTCTTAAGATTTGTTTTCTAAAGTTGATACTGTGGGTTATTTTTGTGAACAGCCTGATGTTTGGGACCTTTTTTCCTCAAAATAAACAAGTCCTTATTAAACCAGGAATTTGGAGAAAAAAAAAACCCTGGTTTTTTATTTTTGTATTTTATTATTGTTTACTTCAAACTTTGTTTTACAGCGTCCTCCACAAAACCTCTAGAATGCACTAGATATATTTTTCTTGGAGTCATAATCATGATGCATACCAACACAACACTACTCAAATTATATTTCATTGAGATGCATGTTGCATTGAGGAGTCAACTTGACATAGAGTGGAGACTTTTTCAAAATGGCTTTTACATCCTAATGAAAGTTTGGGAAGTATATCCTCTCTGCCTTTTCATCAGTGCTTTGTGGTCCAGCTGGCACCCTTTCTGAGGTTTGTGTTTTGTGCTAAATGGTTTTGTCCTTAAATAGGAGAGGCTCAAAAACATCAAGATTTCAGGAAAATGGCGACAGCTGCATAATGGAACCCCCCTGCTTCTATTTTGTTCTTTTAATTACTATTTATAGCCCCAGTTACCTTCTGAATTCTGAAGTGTATATACCTCCATGTTCCTGAAAACAAGAAAACTCTTACTTCCTGATATTCCATAGACTGCCTTCCCAGGTGATTGAGAACATAGAGAATGTTACACATTTATTTTACTCTAAATGATCTTTTACCCCTGTTAGCTAATCTTTGTGTTTTCCTCAACTTTATTAATTACAGTGATTGCATTTTTAGCATCCAGTTGTAAGATGAATATATTAAACAGCTACCAGTGTTGGTGATACCTCATCCTTGAAAGGCTTAGTTCATTTGTGTTTTATACTTCAGTTTTTCCAGCATAGCAGAAAATGCCGCTTATAATTTTTGTGCACACAAACCTTGGATTCCCCTGTAAAGTTGCTATTGTTTCATAGCATGCGGCACTGGCCTTTTTTCATCCTACTCATTACAGGCAAAACTCATGTCTTATTTATGAGGATTTTATAGATCATTTTCTGTAACAGGTGACAAAAGCAGAAAAGAATGAAGAGGCTGAAGTATGAACTACCCTTGGAGCCCATATACATGATATAGGCAATTTCTTTTGTATGTTAATTCAGTCAAAAATACTACCCACTTGATGTTTTCTAATCTGATGTGAGCTCATGTTACACAGACTTTTAGTAAGTAACCCGTGACTAGAAAATAAACTGGATGCTTAGGAGAGAGTGTCAGATGTATAAGATGCTAATAAAACCTGTTTAATATTATTGTTAGCTGTAAGTTTTTGGGAAATACTGAACAAATTAGTCCACAATCAAGTGTCTACTTTTCCCTTCACTGTAGGGCCTCTCCCTGCACAGAGCAGTCTGTTTAGCTGTGAACACCACAATCTGCAGATGTTCAAGTCCCTTACATAAAATGGCATAGTATTTATATGTAACCTATGCATATTCTCCTGTATATTTTAAATCATCTCTACATTAAAATACCTGATAAAATGTAAATGGTATGTAAATAGTTGTAACTTTTTTTATTTATATTTTTGTTAA